Description :
From Genome Similarity Track
Location :
scaffold_199:22257- 26322
Transcript NameFunction/comments
g5287.t1 conserved hypothetical protein

Sequence
4065 bases(100 bases per row)
TGCCATTTCATTCTCTAGTGTGGTGGACATAATGTGCAATTCAACTTTATCATGTTGGAAATTCAACTCACAATGAAATATCACGTTGAAGTTGTCAACG
CGTACAGGTATACCAAAGTCTCTGTGCAGGGGTTTTGGGTCTGTGTCGGGGTTACTGGGCAATGAGTCCATTAACGTTAACACATCAGTACGAGTGCTAC
AGAAGAAAAAATATCGAAGGCTTCGTAAACTACGACAGCAGATACGACTCCCTGTCAGATGCCGAGGGTGAGGCTCACTTTGTGAATTCACCTTCTACCA
ACGCCGCTGAACAGGCAGGTATGTTGTAGCGCTGCAACCCGATATTTGTGGTTGGCAATCGAGGCCGAGCGAAGCAAGGGCGACGGGCAGCAGTCACCCG
CCCTAATGATCACCACTGTTGTACTTTCCTCTTCGAATCTGGAAGCTCGACTCGACGCGGGTTGCATCTTCAAGATGAACTTCAAGATGAAGGAGGCTGC
GAATGAACCGGACTGAGCAGATTCGGATGATCACCGTGCAGGTGACTTGGTTAACACTCTATATGTATGGATAGCTAGATTCGACTTCATGACTAGGCAG
TGCTGAAGGTTTTCCTTGCTTTCCTCACCAGGCTCCAAACAAAAATCAATTCATTCTCACATTTACCTCCAATCCTTAAGTCGCCTACTAACTCCAACAC
CAACAACTTCCTCTACTTGCCCACCAACTTTGTCCCCGCTCTGTTTCCAAGCTCCAACTCCATTGCACCCGGCAGGCCGAGCCCCAAGGAATTCAACAAT
TGGTAGCACTTGCTTCCGTCTGTGGAGGATTAGGAGAAGTTTTCGTTGACGCCAAGAACCGGTGCCCATGTGCGAGCCGCCGCCCGCATATGTGAAGAAG
AAGTAGGCCGCCATCGCACGTCTCGCGGTGACCATGGTGGCGCAGCAAGAGGAGTTGAGTAATCTAGTAAGCACGTTCGCGAACAATCCACCCGAGAAGT
GCCGAGTTGAAAGCATGCCCATGCCGACATTCGGGGCAAGAAGAGCGTATCCTTGGATCTGTTTCTCGACCGAGTCCTCATATATTTGGAGGCGAAGAAC
ATTGATTATCACGCCGCCTACAACCACAATGAGTGGTGACAATGATGGCCTCTCACCTCAAAGAGCCTGCCGCGCCTCGAAGTCATCGCTGACTACCATG
GATTCATTGGCCGAAGACCTTCAGCATGAATTTGTACCTATCGATCTGCAAGAACGACTTCGAAGCGATCTTCAACAGCTATGTCAACGTAAATGTTCTG
ACCTCGACGACTACATTGCCCAATTTCGACAATTGCTGTCGCAAATTTGGGCATCGTGGCTTGGACCAGGGCACCTGGTTCATTCAAAGCCTCGTGCAAA
AAAACTCGGGAAGAAGTCGTTTATCGTCGGTGCCAAACGGTGTCTGCAGCTATGACAATAGCTTAACAATATGAGCGATCTCACCCGAACAACTATCCTG
ATTGGAACGGCGAAAATAATCGCTGGGCACAGCGTGAACGTATGCCGGTTCGCTCAGCACGACCTCGATTTCCCCCGCCGGATGATCAGTGAATCTGTGG
AGATTGGACATGTCTAAGTCTCGCGTGAGCAGTGTCGCCGTAATACTATTGCAAGCATACAGGACACATGCTTGGTTGTGCCCAAAGAAGGACAGCAGTG
CTTGTAACAGACGTGTCTACGTCTCGGAGATGAGTCCAATCCAGTCATGCGACGCTCAAATGGATGAAAGCCCACCGCCAAGGTGATTCAGCTTGGGTCG
GTATAGACAATGGTGCTCATCATGAGAGGTTGCGACAAATTGACTTGTTTCGCAAGAATGCTGAAATCAACGGAAAAATTGCTCGTGTTTTGATTGATAC
ACCAACTTGATCAGACCTGGTTATCTGTCAGGGCAGTTGGTTGCGCGCAAAGTCAATATCGAAGGATTCGATAGTGGCAGACTGTAAAATTTCGGTACAA
GAAGGTGCTTGTACAATCACATTGGACCTGCATCAATTTTCCGGCGTCCAATTCACGGAATTCGAGCTACCTACTAGTCACGACGTCATTCTGGGAAGCC
TTGGTTAACGCAATTCAACCCTTACCTTGACTGGATTACACATCAAATCACTCTAGATCTCCCGTCAGCTATGCCGACCTCAATGTGCTGAATTTGTCCG
CCGCATACAAGCATGAGCCGCTACCAGCACGTGACTGCAACTCTGCTATGTCATCTGCACTACCAGAACTCCCACCTCGGTCTCCGTTCGGGTTTGAGGC
AATTCTGGATATAGAGCACGCGTTTTACATCAATGTTAAGGCGTTGCAGATGAAGCTAACATGACCTCGCTACGAGCAGTCATACTGAACGAGTTTCATG
ACGTAATACCCGACAACCATCCCGCTGGACTTCCTCCACAACGTGCGTGGAGTTCGAAATAAATCTGAAGCCGAATGTCACGCCTCGGAATCGCCCACTA
GTCCGACTATCGAAAACAGAGCAGAGCGCACTCGACATTTTTATATCGAGCATGTTGGAAAAAGAGTATATCAAGCTGTCGAACTTACCTTGGGTCTCGA
ACGTGTGTGCAGTTCCAAAGAAAACCCAGTTCTGGAAAGGCTCCGAAGAAGTCGTAATGGGTCAAAGCCGGCGATCCATCGTAGCCAATTCGCTGGTTGT
AGACTGCAGATTTCTCAATAACCAAACACTCGTGCCCAAGATCCCATTCCGCACATCGATGAGTTATTTGATAGAATGAGTAGCGCAATATTTTCTTTCA
ACTCTTGATCTATCAGCTAGCATGGAAATCGACGCCCTTACTCCAGATGATGATGAATCAAAAACCAATCGCGCCTAAAAAAAAGGTCAGTGTAGAAGAG
TTGAAGGACGACTTCGGTCCAAACCCCAGATCTTGCGGTGGTAAGCTAACTGTTCTGCGTGGCAAGAACCCGTTCAAATTGCCCTCACCCCGGAAGAAAA
CGTCGTCTCACGCGCAGCGTCAGCGCTAAGAAACTGAGGGCATCGAGACTGAAACTCAAGGTGCTAAAACTCGAGGTGCTGAAAGAAGAGTGCATGACGG
TGTGTCACTACGTCGCTGCAACCGGTGGGCTGCACACACATACAACGACCTGATATTGAGTGAGCTGTTTGCGTATTTTCCAGTCGTAATACGCGGGAGT
TCAAAAGAAACTTAGAACGGTGGTGACGGTGGTCGAGACACAAAAACCGGTGGTGAGTTTAGCAGTTGTATTCGACAACGAAATACGTGACTAGTGCAAT
ATGGAGCTCCAAAGCCGACGGTGCCGCCTAGTTGCGGACTCAGCTCAACATGCATCTGAGTTTGGTGCTTTATTTGGCGACGACTACTAATCAGAGTAAG
TATTGAGCGTGCTGATCAATAGTTTTGATTGATCGACTCTAACACCTACCCTCTACCCTGCATTGTTGTTGTCTAGGAACCTTGCAAAAGCCATGACAAT
TTCAGAGCCTACGCAATGCGTTGTATCACAAGCGCGACGTCATCACCTTCGTCGACAGAAAGTAGGCGGAGAATGAGTGTCAATATAGATCATTGTTGCC
TTATGGATAGTTGGATCAGGAAATATGGAAGCCGCCCTTCATTCAAGTTCGCTGGACGCAGGTGCGAGAATTAGCTTGCAGTTGAAGCCTGGTTCACAGA
TTTCTATCGCGGTTAGAGACATCTTACAAGTGCTACGGCTGACAAAGTAGTTTACCGATCGAACAATCTGCGCGACGCTTCAAACGTTTTACAATTTCAA
TCATGAAGCATATTTCTTGGACCCGCTGGTTGAAAAGGGAATGAAATGGGCAATACCAACCAACCAAGAGTGGAAGCTGGTCATTGCACCATGTAACATG
AATAATATCCACTGAACGCTCGTGATTGCTGCTTAGACAAGCATACGGTGGTTGTGTACGAGCCATTGATGCAGAGCTTTTACTTCGATCAGACTACACA
TTGGTGCAAGGGCGCCATATTTGATGCTATCTATCAATGGGAGCACAAAACCGGAAGGGATCACT