Description :
From Genome Similarity Track
Location :
contig_35:222551- 224423
Transcript NameFunction/comments
g6772.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
TGGTGTACCTGGTACTGGACAAGACGTAAGTGATCTACCAAGATGACAATACCTCCTCCCATAGACACAAATCTAGTGGTGTTTGGGAGCTGGTCAAATT
TGTTCTGTTTGATACCATACAATGTGAGAATCTTGATGTTTTCGCAGCTTATGGCTCTGGAGTTGAATACTCTCGTTGAATACTCTCAACTCGCTAATCC
AATTTTGCTTCGACGAACGAATGGTGTTCGGGGTCAAAGAACTGGATTTTAGTCGTGCCGGAAGTCTCTGAGTGCGTCGCCAAGTGGTTCGAGGACTTGG
TGAGGAAATGGTTACAGAAGTTTGTTATCGTCTTTTCGACGCTGTGACCCACGAAGCGATCCCTGGGACCCAGACAGCTTCTGTGAAACGAGTCGATGAT
GTCCAGGATATTGAAGATCTCTGCATCAAGATTCGTGAGCTTGCCCGACGACCATCAACGCCACGCAGAGACATTCTAGCGAATGTTGCGCTCATGCAGA
TGAAGGTGCACCGGAACAGGGCGGCATATGATGCAAAGCGACGGTCGATACCATTCACAGCTCACCTGAACGGGTTTAGAAAGGATGGGTTAGTGCGCTC
ATTGTCGAGGAACCGCTACCACCGAGGGAAAGAGACGTCTACTACGAACTAACAGCTGCCGACGGTGGTCTCGATTTCACAGACACTAAGCATCTTCAGT
CCGTCTAACGAACTTGAACAGCATCGACGACTTCAAGAAGAACGTTTTGGACTTGAGTCGCCCGCTACTCGCCGAATATGCGCCACATCATGTAACTGTT
TATCCGGACCGGGAAACGAGTGGCGCCTTGGCGGTGGATGCCAGACTTGGGACGTATGGTGCATCAGCCGCGAAGGCGCTGGTTGTGAAAGTGCCGTCGC
GACCAAGTAGGCGGCTGAAATCAGTGTGGCATCAGACGGTGACACTTGACCCTGCTGCTTCCAGACTGCCGCTCGGTGAGGAAAGCCCAGTGTGGAGAAT
TGATCCGACTGCTATGGTTTTTTGGTATTTATGAGCTTTGCAAGAAGTTGTGCTTGTACTGTCGCGTTGACACTGTTAAGTTGGCCCGCTTCTTGCAGAT
CCATTGTTTTGCGGTAGCACCTCCAGTGTGTGTTCTCTTGGAAGGAAACGAGAAGATAACAATTTAACAGGAGGAAACAAACTTACTGAATGACATGGAC
CTACTTCTGAATGAAGTTGAAGATACAAAGCAGCACATCGTGTTTCTTGATGGGGTTACACAGGAACAGGACCAGGCAGTGCGTGTTTGTATTGGCGCGA
GGTAATTCTGCTATCGAAATACTACTTCGCTGGCGGGAATGTTCGCTATATGTTTCACTATCCAAAAGCGCAAGTGATAAAACCCCTGGATGAGGCTGTC
CAAGCCGCAGTGGGGACCCCATTGAGGGAGCGTATAAACACAGCTTCCTCATCGGTTACTTCAAGAAACTTTTAGACTCGCTCGCGGCAGCGATGTTTGA
GGTCAAGACGCTGGAAATTTTCTTCGTTGTGGAAAGGCAAAAGCTGCTCCCTTTCAAGTTTTCCGTGGTGACCGGTCAAGGAAACGTGATATATTATGGA
TGGCAGCAGGGCGAGGAAACAGGCAAAGTGAGGCGTGTAGCCGTTGAAGGGGTCGAGACCTGGAATGTATTGAATTGGTGAGCAAGGACCTTAATGACTG
GTACGGAATGGCCTTAGCTTTTTGGCAAAGGACACAGAAATCGTTGAAATTGATTCACTATTGTCGGACTTTTAACCTTTAATCCTTCTACATGGAAAAG
CTGAGCTCCAAGTTGCTTCACGGGGTCGAATTCTTCAATTACATCGATACGAGAGAGTATGTGAAGTGCTTG