Description :
From Genome Similarity Track
Location :
contig_58:222528- 224573
Transcript NameFunction/comments
g10432.t1hypothetical protein

Sequence
2045 bases(100 bases per row)
GCGCCCAAGAAGCAGTATGAGCTGGTGGTGCAGGACGACTTCCTCGTGGTGCTGCACCCCGTGCATCCGCTGAGTCTGCAGATCGCGCGCTCGAGCGGCT
CGGACGCGTCGCTGGGGCTCGCCGTGGAGCACGTGGCGGACTCGCAGCACGTGCATGGGCGGCGCATGGCCTTCGACGCCATCTACGGCGTCTTCTGGCT
GCTACGCGGGCCCTACCTGGCAGTGGTCACGCAGTCTAAAGTGGTGGCCAAGGGCGTGGACGGCCACGAGATCCGCGCGGTGCACACGCTGGAGCTTCTG
CTTATCCCCACGCAGAACCTGCCGACGCTGACGCCGCAGCAGGAGCAGGACGAGCGCACGTACATCGACATGATCACGGGCGACATCGAGGCGCAAAAGC
TGCACTTTGCACGGGACTTGGACCTCACGCACACGCTGCAGCGTACGGCAAGTGGAAGTTGATACCTTTGGACAGTGAAAATGACGGTAGTTTACTGTCT
TGTCAGGCATTGCGGCGTTCGACGGCAGGATCGGCAGTATTGCCGAGCGCGCGGACGAGCGCTTCTTCTGGAACAAATCGCTGTGCTCGGCGTTCATTGG
TACGAGACGCTGTTGAGGGCTGGTAGGGGGATGAGACTGATACGTTGCGCTGCAGAGCAAAAGTTCTTCGAGTGGGTGACGCCCATGGTGCAGGCGCACG
TGGAGGTGACGGAGCAGCTCAAGGTGAAGGACAAGTCCTTCCGCATCTTGTACATCTCGCGAAGGTCGTGCAAGCGCCAGGGAATGCGCTTCACGATGCG
CGGCATTGACGACGATGGCAACGTCGCCAACTTTGTCGAGACAGAGCAGATCTGCATTTTTGACGACGGGAGGCAGACGTCGTTCGTGCAGATTCGGGGC
TCCATCCCCGTGTTCTGGAGCTCGCCGTTACGATGAAGTACGCGCCGAAAGTGTACCACGCCGGCGATAGCGAGCGCGACGTGGCGGCCTTCCAGAGGCA
CGCGTACCAGCTCATGGGGCTATACGGCCGCGTGTTGTTCGTGAATCTCATCGACAAGAAGAAGGAACAGCTCAAGCTAGGCGAGGCGATGGCCAAGACT
GTCGCCGACGCCGCTACCAAGGACTCGCACATCCTCGCGGCCGTGCGACTCGTTTGGTTCGATTTCCACCACGAGTGCCGCAACATGAAGTGGGGCAACC
TCGAGAAATTGATCAAGCAGGTCGACGACGACTTCCTCGACCACGGGTAAGTGCCATACCGCGCTTGGCGGTGGTTTATCAGAAGCTGATCGTGCGTTTG
TGCAGATACTTTTGCAAGGGCGCCGATGGCTCGGTCGTGAGCAAGCAGTCCGGTGTGGTGCGCACCAATTGCATGGACAACCTCGACCGCACCAACGTCG
TTCAGGTGCGTCGTTCGAAGATGTCTCCTGTTGAAGTCGACTGCTAACCGCCCCTTTGTCTCGCCAGTCGCTGTTCGGGCGGCGGAGCCTGATGTTGCAG
TTAAACGAGACCGAGGCGCTGCAAGGAAACGTGCTCAACTCGCCGTTCGAGGAGTTGGAGCGCACGTTCAAGCGCGTGTGGGGCAACAACGCCGACGCGA
TCAGCCTCTTCTACGCCGGCACGGGCGCGCTCAAGACGGACTTTACGCGCACGGGCAAGCGCACCAAGAAGGGCGCGCTCATGGACGGCTACAACTCGTG
CGTGCGCTACATCATGAACAACTTCATGGACGGCTACCGCCAGGACGTGCTGGACCTGCTGCTCGGACGTTTCTCGGTGTCGCGCAGCAAGCCGTCGCCG
TTCCAGACGGCAGGCGAGAGCCTCGAGTCGGTGCTGGCCAAGCTCATGGGGCTCGTGGTCGCCTTCTTCCTCGTGGAGACGTACCGCAGCAGCGGCCAGA
GCTTCTTCTTCGAGCGGCTCGTGCGGTCGGTGCTGCTGACGCTGCTCATCTGCGCGGGCGTGTTCAGCGTGCTGGTCAAGAAGGGCAACTCGCTGGGCCA
GAAGCTGGTGCGGCTGCCGAGTTTGCGCCCGCAAGACGGCTGCAT