Description :
From Genome Similarity Track
Location :
contig_54:22251- 24263
Transcript NameFunction/comments
g10749.t1hypothetical protein

Sequence
2012 bases(100 bases per row)
CGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTC
CAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGACGCACCACAGTCCACTAGTTTAGCT
AGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCCTTTGCCGATCGACAGAAG
CTGCTGTTGCGTCCTGGACAAACCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTT
CGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCG
TCACAGCTGATACATTGCTTGTATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTAC
GCTCGGTACGCGTGGGTGCCTCAAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGGTGGCGAACTCCGCCATCGGCAAG
CAGTCGCTCCATTGATGGAGCGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCG
CAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGAGAGTACTCGGATA
CTCTCGGAAGAGATAGGCCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGTGTTGGTCACGATGTTCGAG
GCCAAGTACCGTGCCCCTTGGGCGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTTGATCGGAACTCGTTCTGCGGGGGCT
CAAACGCAAGTTTGAGCTTCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCATACGCCCAACTCCTCGCTCGTCCGCC
AAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCC
CCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTT
CCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCG
TTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCC
GAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGTCTGCTTAG
ACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACC
TAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCT
GCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGA
CCACCCTGTGGA