Description :
From Genome Similarity Track
Location :
Scaffold_8:22250- 23783
Sequence
1533 bases(100 bases per row)
GATGACGCAGACGACGACACACTATGTTTTGAGCTAGTCTCCAATCATCTCGGTTGCTCGTTGATTGGAGAGTTGGCGATTACAGCATTTCGTCACTCGC
TGAACCCTGAGCCTCGCGTTATTGAGACGAATGACGACTGGATATCATTAACCACGTCGCGGGAAGCGAATGCGAACAAAAGTAGCGCGCTTCCTTTAAT
TGCGGAAGCTCAGCTGCTCGTACGAACGACCTATGCCCCAGCGCTTGTTAGTGACATGGAACTCAGTTTCGGACCCACACGATCACTTTCTGGGTCGTTG
GTGCGGGGAAGTATCGCTATGGAAAAACACTTTATTAAATGCATGTGGCAGACTCGATCGTACACGACCGAAATACTGGGGCTCGATACTAACGAGATTG
AGTCCAGCATGCCCAAGACCACACTTGTGATGCCATTGGACTTGAGGGTCGAGAATAGTGCAAGCCAAGCGATGCCGTTGCTGCGCGTGCAATGGATGGG
GTTCTCGGAAGCGATTCCCGCCTTTTGTGTGGGTGAACTCGAGATGGATCTTCCAGCATTATGGTCTACAGGGATAAAGACGGTGACGAGTGCATCTACA
AGCAAGTGGTATGCAGTGTACGATCCGCACGACTCGACGAGGCAAACGGGATTTGTGAATATGCGCGTCACGTTTCGCTTGTCTCGGCAAGCCGCACAAC
GAAACACTTCAGTCGTGATGCCACTAAGTCACCATCGAGCAACCGCAGAAACAAAAGAGTTGTCTGTCAATAAATGGACACAGATCGAGCGACGAACCGC
GGCAGCAGAGAGTCTTGTCGTGTGGAAAAAGCTCTTTTATCTGCTGGACGAAGACGGAAACGGGCGCATCGATCGGACCGAGTTCAAGCACGTGTTCTTA
CATCACGCGGAGGGTACGGTGCTTCAATACCGTCATTCATCCTTTGCAAATATTACACTCACGCTGACAAATGTGGGGTTACGTCATTCTTTTTTGTGGC
GTTGTTTGGTGAATCTGTGCAGCATTGGCCGCATCTCCCGATGGTCAGAGCCTCTTTCGACTGTTGTTTGGCACGGTGGCTCCAATGTCACCATCGGAAA
TGCAAATGGACACGCTCTTTGCGGAAATGGATACCAACGACGATAATGTGCGTCATTTGTCGCACTTCCTTGTGCAGAATGGTGTCAGTATACTTATGTC
TGTGTGTTTGTTCACATTAGAAAATTGAATGGAGCGAGTATCTTCGCTTTCTTTGTCGAAAGCAGCAGGAGCGTGGTGGCGACATCGCCCATGACGAGAC
TGATCACCTCGATGACGAAGACAGCAACGAGGAGGAGGCGCGATTGGCCACACTCCCGATCTCCACCATGGTGCACAAGAACGAATTGCGCACGAAAAAG
CGAGAAGATGTGAATGCAGCGCCACTGATGCGTGCTCCCTCATTTCAAGACACAGTCAACGCCAGGCAAAGTCGACAACAGTCGAAGAGCATCCCTCCTC
CATTCCCGCCGACGACAGCGTCATCAAGAGCGA