Description :
From Genome Similarity Track
Location :
Scaffold_41:2225- 4541
Sequence
2316 bases(100 bases per row)
CGACGCCGACGTGCCCGCTTCCTCTCTAGGCACTACACCACAAAAGGCTGCGGAGATGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTAT
GCGCTCGTCACGTTCAGGGTGCACCTGTTGGGCTCTCAGACGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGTCTCATCTCT
CGTAAAGGATGGCTCGCTGGCTGTCCTTCTTCGTGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCG
CAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGTTG
CTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGACTGT
TGTTCTACAACACCGGCCCGATGGATACTCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTATTGCATCCTCTATGAGGTACACGACACGCCGCA
GGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGT
GAGACGTGTCAGCGAGTGAAGTCGTCCCCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCATCGGGCTGCTGGCAATCCATGAGTATGGACTTTG
TGTTTGGCCTGCCGGCGGACGCGGCGGGCAACACAGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCAT
CGATGGTAACGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACAGGC
AACTTCTGGAGCGCGGTCTTTGCGGTGGTTGGCACCAAGCTGGACATGTCCACGGCGGACCGATGGTCAGACAGAGCGCGTGAATCGCGTCGTCGAGGAC
GTGCTCCGCAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCT
ACACGCCGTTCTACGTGAACAGCTTGTCTCACCCCCGCCTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGATGGGGGAGGAGAAGCTGATCGGCT
AGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGACGCAATGGCTGAGAGC
CAAGACAAGCAAAAGGAACATGCAGATGTCAGGGGCAGAGGCAATATTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCAAAAAACTACCTAC
ACATGCAGTGTCAGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTT
CCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGAGCTTGCTCAAGCCGTACCAGGACCCGATGGAGGTGCAGATGGAGGCACCGAGGGTGACGAGGT
CACAGGCACGGAGGTCGCAGGCGTCGAGGACGCGACCATCAACGCGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCACGGGCACAGCG
AGAGCCACAGGCGCAGGAGGCGCAGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTTACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGA
GCTCCCGGCCACGCTGCTCATCACGATCGCAATAGCATCGCACCCAGCCCTACAGGGCCCCAAGGCGGTTCCAGCCCTCTCGAGGCACCTCGATCCATTG
CGTCCGCTCGGCGAGCTGGTCGAGTTCAGTGGCAGTCCGGCCCAGACGCGCATCAACGTCATGGATGTGATCCCGAAGGCGGCCCGCCTGCTGCCGCGTC
TCCAAGAGCTCATCTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCACCGGCTCTGCTCGATGAGCATGGGAATCGGCATTACCATGTGGAGCGCCTCCTG
GCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAG
ACTGCCCAGACGTCGT