Description :
From Genome Similarity Track
Location :
Scaffold_12:222495- 224231
Transcript NameFunction/comments
Phyra_75315Poly(A) polymerase, putative

Sequence
1736 bases(100 bases per row)
AATTTGGGGTTGGAAATTTGGAACGCCAACGCAGGCCACAACCGGTGAGTTGGCTAGATTGCTGTCAGCTTTTTTTTCTAGACGAATAACTGAGTTTGGA
TGATTGCTCATGTGTTTTTAGATACCAAGTGATGCCGATCCTGACGCCGGCGTACCCGTCGATGAATTCCTCGTTTAACGTGTCGACGCACAGTCTTACG
GTTATGAAGGAGGAGTTTAAGCGCGGCCTGACCATTGTGCAAGATGTGCTGAGCAAAGGTGGTTCGGAATGGGGGCCACTTTTTGAGCCCTCGGACTTTT
TCGCCGTCCACCAACACTACCTCGCAGTCGAGGTGTACACGGAGAAGCAGGACGAGGAGCAGGCGTGGTGCGGGTTTTGCGAGTCTCGTATGCGTAAGCT
GGTGGAGTCGCTCGCCTACAATCCGGCGCTTTGCCGTTTGCGCGCTTTCACGAAGAAGTACCCACTGAACTTTGTGACAGGTGGTGAGGCTCCAGCGAAT
GAGCAGTCTAACGGCGGAACCCCAGCGCAGCCCAGCAAGTTCGGCGTCTGCTTCTACGTGGGCTTTGATATTGACCGTCGCCAGCTGCGCAGTCGTGAAG
TGAGCATTGACAGCTCGGTGGAGTATTTCAAGAACAACGATCTCTACCGCTGGAACAAACGAACGGCGACCATGGACGTGAGAGTTACTGCGGTTGTTTG
GAAGTCTTTGCCTGAGAGTGTGTTCGAAGAGATGGGTGGACGCGCTGTTGCACGTGTTGTCCGTCGTGAGTTTATGAAGAAAAAGAAAGAAGAGGAGAAG
AAGGCCGAGGAGGTCGCGGCACCAAGCCCTCCGCCTTCGGGTGATGAAGGTGTGCACTCACAAGAGGATGGAGTGGAGGATTTGAGCAGCAGTCAACAGG
CAGCGTCACTTGCAACCGAGATGGCCAATGGAAAGGGCAGTATTTCGCAACCAGGTAGCCCGAATCCTGCGGCTGACGGGAGTGAGGCGACAAACGGCAC
TGATTCTGTTCACAGCACTCCTGTGAAGCCGAAGAAGACGGTGTCGTCGGCGTCTCCAGAAATTACAGGTAAGCGTGATCGCGATGGCAAGGCTGTGGTT
GAATCCGGCAGCCCGGACGGGAAATCGTTGGGTGCTGCTGACAACTCTGCCAATACGTCGACAAATGGTGCGTCGGCTCAAGGGATTACTTCACCTCCCG
CAAAGGTGGTGAAGAAGCCCGTGGAGCAGGCGGCGGCCCCCCCAGCCGTGTCGTCACCACGCAAGAGACGTAAAATGAAAATCACTTTTGCCAAACTGAA
TTGAGGAGGTTGTGCCCGGGGCAGTAGTGGCGTGGGTGAAACGTGGCAAAAAAAAAAAAGAGGAACACCATGCCATGGAAAAAAAAAGAGAAAATAGTTC
CCCACAGAAAAAAAAGAGGTAGCAGCAGCAGCGAGGATTTGCGCGGACACTCCTCGACAACCATGATGAAGCGTGCAGAACGGCGATATGGTGAGTGTGA
ACAGACTTTCTGTTTGAGAAGCGAGTAGCAGCCTCATGTGCGTATGATCATGATTCCAGGCTCGCGAACGACAGCGACGAAGCGCTACCAGACAAGACAC
TGCAGGCGGTGGCCGTCACCGGTTTTGACGAAGATTGAACTCTCTTTCTCGTCGACCCGGGGTGAATAGATAGGAAACACACTTGCAGGTGGATCATAGA
GGTGGCTGTCATCTTGATGCAGCTCCCATTGCTCAG