Description :
From Genome Similarity Track
Location :
contig_54:22246- 24256
Transcript NameFunction/comments
g11226.t1OWZ07258.1 putative membrane protein [Phytophthora megakarya

Sequence
2010 bases(100 bases per row)
TAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAA
TAGACTTCGAGGTGTTTTCACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGACGCACCACAGTCCACTAGTTTAGCTAGG
TTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCCTTTGCCGATCGACAGAAGCTG
CTGTTGCGTCCTGGACAAACCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGC
AGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCA
CAGCTGATACATTGCTTGTATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCT
CGGTACGCGTGGGTGCCTCAAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGGTGGCGAACTCCGCCATCGGCAAGCAG
TCGCTCCATTGATGGAGCGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAG
TCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGAGAGTACTCGGATACTC
TCGGAAGAGATAGGCCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGTGTTGGTCACGATGTTCGAGGCC
AAGTACCGTGCCCCTTGGGCGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTTGATCGGAACTCGTTCTGCGGGGGCTCAA
ACGCAAGTTTGAGCTTCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCATACGCCCAACTCCTCGCTCGTCCGCCAAG
ACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCC
TCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCT
TCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCCGCCGCTTCCCCAATGACTGTTGACAGTCGTT
GGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGA
GGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGAC
CCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTA
GATAAAGGAACCGAACGATAGCTTTGATGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGC
CATTGGATGGTTGGCAGAACCCCTACCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACC
ACCCTGTGGA