Description :
From Genome Similarity Track
Location :
Scaffold_2:2224593- 2232695
Sequence
8102 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCATTTGGAGTTT
GTATACTCCTGCTCCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTATCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCT
GAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCAT
CTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCC
CACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAA
ACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGTGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGG
TCGCGCAAGAGTTGGGCATATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGG
CGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCCCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCAAGTGCTCACTGCCTC
TTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCA
AACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGTGTACAGCCACAAGCAGGCTCGTACCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGG
CGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGTAGCGCGACATTCGCCGCTACGGCTGT
GGCAAGCTTCGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCACTGGCAGAAGCCGCG
CCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACAGGGGAAACACTAAGTCTTCATGAGGGGTGTGCGGGTGGCGCACGCCATG
GGGACTTAGGCCACGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTT
GAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAA
GGCAACGAGCTGGTCTCGGTAAGACTGGCGGATGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCA
CGGAGCCGCTCTTGGTCCTAGACATCGACAAGTACGACTTGATCCTGGGCATGCCGTGGCTGGAAAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGC
CATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCACCCGCGAGGGCCGCCAGGGCGCA
GCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCAGACCGGGCCGGACAAGGCCTGAGATTGGAGGTGCCGGACAGCACCTACCAGG
TGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACG
CGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCG
GGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCAGACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCA
AGGACAAGGCGGGTAACGTAGTCCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGACGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAA
GCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGACCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGC
GTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCTCGAGGATTCAGAGTTGCTGAAACTTGAGGAGCTCGCCATGGAGGACTTCT
TGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGT
CCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTTTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGAC
GTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGCGACACGAGGCAAT
GGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGACAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCC
TACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATATCAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGC
AAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCC
CACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCAC
ATAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAAGCAGGCCAGACGGACATGGAGGTGCAT
CTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGG
GCTGCTTCGTCAGCATCGCCGGGGTCCGGGCGGACCCGCAGAAGGTGAAACCCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTT
GTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGCCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGG
GAGCGTCGCCATCAAGATGCTTTTATCGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCT
GTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTGCAGGCAGCCGAACGGAAC
TATCCAGTACACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACC
ACGCGTCCTTGCGGACTGCTGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTCGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAA
GCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATC
AGGCTGGGGTACCGAGACGATGCCAGTCTCGGAGCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTG
CAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGATGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAA
GTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCAC
ATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGACACGCCTCGGCACCATTGCAGAGCCTGCCGGTCC
CAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGAACTTCCGGCCGATGACCGGGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGCCTGAG
CAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTCTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAG
ACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTTGGCACACGACTGTCGATGTCGACGGCGGACCACC
CGCAGACGGATGGCCAGACGGAGCGCGTCAATTGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCC
CATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTA
CGAGGCAGTACCGGGGCTTCGTTCCTAAGTGGGGGAGAGGCTTGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAAC
TGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGTAGGGTGCGAGACACCATGGCGCAAGCCTAAGATAAACAGAAGGAGTACGCTGACCGAAATGG
AAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTG
AAGCACCGCTTCATTGGACCCTTCACGGTCTTCAGCCGGCATGGCGCGGCGTACACCATAGATTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACG
TGGGTCGTCTTAAGAGGTACCATTACCCTCTGGCTCTGGCTGCCCCGCAAAAAGCGGTGGGTGGCCCGGTGGAGAAGAGTGCAGCTCCTCGAAGCGCGGC
GTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAA
ACTGGGCCTGATACGAGTGGGTCTGCTGCTGCTCCGGATACGGCGCGTGACCAAGAAGTTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTA
AGACGACAGGTCGGCTCGATGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCCCACGGCACCAGGCT
GACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGATGACGAATCTCCTCTTGCTGCAG
GGCCACCACCTGACTCGGGGCCACAGCATACGGCTGCGTCGCCTCAGGCTCGTACCCATGGCTGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGG
GCAGATCCACTACCACGTGGAACGAGTCGTCCGGGTGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAAC
TCGTGGGAGCCCGTTGAGCAGCTCCTGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTT
GGCCGGTACCCGGGGTACGGTAGCAGGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTG
GAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGTGTGCGATCCTCACGGAGTTCTTTGAACTCT
TGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCTGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACA
CAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTTCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTC
AACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTC
TCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATTCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAG
TCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCATCCTC
GTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCG
GCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCG
ACTTCCCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTCCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCATTCTCTGA
CGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCG
GGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGC
CTTGCGCGGCGTCAGGAGACTTGCTCTGAGCCCCTGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGC
CTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGC
TTTGGAGGCATGCTTCCGCTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCG
CCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGTCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGT
AACGGGGTTACATGGAATAGTGACTCTGTCACTATTCCGGGATGGCTACATGGGTCACTCCGCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATA
CATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTCAA
GTCAAGTCGTCCCCTTCAAACCAGGGACACGTGAACGGCTGTTCATTTGGAGTTTGTATACTCCTGCTCCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCA
CA