Description :
From Genome Similarity Track
Location :
Scaffold_159:22242- 24600
Sequence
2358 bases(100 bases per row)
AATTGATCCGATGATATTTGTAGTATGCGTAGGCGCTGGATCTACAATGAGCCCGGCGGCTTGAAGTTGTCTGTATCGTTGGATGTGTTTGTTTATATGA
CCAGCTTTGTGCATCTTGCGCATAGACTTGAGGACATTTTGTGCTCTTCGGGATTTGATGTTGTGCTCACCAAGAAACGAAAGTAACTGCATTTCGGCGA
CATCGCCAAACTCCAACACATCGTCTCGATACTGCGGAGACTTCTCATCAAGCACGAATCCATTAGCAAGAAACAGCTTCATGAATGCAGCGACAAGTTT
GGCGGTGAATTTCGTGTGCTTGCTCGAGCTTCAAACGAATCCCAGAGGCGGGGTTCGTGGGTATACCAGGGGAACCAGACGTCCTTCAGGTTTGTTGACG
AACTCGTTCGGCGACGTTTGGCTGGTGATTCTTTGCTTTTATCCTCACTTCTTTCATTTGTAGTTTTTCGGCGTGCTTTGTTGTAGACCTCAGCTTCAAT
CATCGAGACGCGAGATTCGAGCATTTGGTTGACCTTGATTAACTGTTCAATCAATGACGCTTGACGAAGATACATTGGATACTTTCTGATGTCGATCGTG
CTTTATTAAGACTTGGTGGGATTTGGTTGCATACTTGTTTTCGTGTAGCAGGTTAGATGTGAAGACCAAGCTAGAAGATCGCTGACGAAGTGACCTTGCT
GGATTACACACGCTTCCCAACGTGTGACTAGAAGTCCGTCTTTCTTAAACTGCTCAACGATGGATAATGAAGTAGCAGGTAAGTGATAAGCGTTTCAATC
ACCTTTTCTTTCACGCTGTAGTGTGTAGTCATGAGCCCGTAAGATTCATTGAAGAGTGCTGTCGCAACACTTTGTATCTTTGTCTGCGTACCGGAGTCGA
AGACATCGAGGGATAGGAGAGAGACGTCGGTATCGGGGTATCACCCACTCAATCCATGGGCAACCTTATGGTCTTTGGAAGCTGTTTTAAAGACGTACGC
GAAGGCCTTATTCGTCTCTTTCATATTCCAGGCGACTCGGTAGAAGATCCACTGTACACACAATCCAGCCCCATTTGCATGCTGCGCCCCTCCGCGCCGA
AAAGAGTGAGATGTCAAGCGCTCGGATACGCCAGATTTTGCAGCAACCTGATCAAGAACACGGTTGACGTAGCTGTGCCCACCAGGAGAGGTGTCTGAGA
GAGAGAAACGGTGGACGGTATATCCATGAAGACAGCACAACCTCTGGGTGATCGAGCAAATCGATGAGCGGAGTTGCTAGAGCTAATATGGACTGTGAAA
TAGCCATCTGCTCAGGAAGTTGAGTCAGCACGGATATAGTTGGCGATGAGTGGGTCACGATGGCGAGCGCTATGGCAAGCAGAGGACATGTGGTGAAGTC
TTCGTCAGGGAAGAGTGATAGACCTTGCTCTTCAGAAGTCTTGATTCGGATGAAACGGACGAAGAATATGTCGCCCGAGCCGATAGACAGGTTATCCTTC
GCAGAATTTTGAGGTCCGATGCACGCCCAAAGAGAAAACAAAGCAGACACAACAGCGCCGCATCTTGGTAGCCAGCACTAGTAACCGCAGTTGAATACAA
GTAATCCATCATTTTCTTGAGAGCAGACTTTGTGCATGCTTGGGGCTTGTTCACAAACGACCCTGATTCACGCTTCATGTAATGGAGTTCGATCGTCTGT
CCCTTCTTGAGCAGATTCTTCTCAACCACTGCTCGATGCTGTGGGAACTGCTCCAGCAGCCAATTCTTGGCTTGTCGAAAGTACTGTATGACCGAGTGTC
GAGCTAAGAGCTGTCCCTTTCGGCCCCCTTGAACGCGAGATACATGCCAAACTTGTCCATCGCAGCTTCTAAGGCGAGAGGTGCCCTCTCGCGCTGCATG
CATTATCGCAGGTACTCCCAAGTAACCTTTTCTTCCTCAAAGAGCTTCAAAAATAACGCGCTGCGTTCTCACGGGCACGCTTCGTGTTGGCAGGTGCTAG
GTCGGTCAGACTTATCCTCGGCGGAGATGTTGAAGCTTGGATGTTGTTTGTCAAATATACAATTGAGTTACCTTTTGTCGGAGATGTCGGAACTTGGGTG
TTATTTTTAAAATATGCGAATGACTTGGTTTTTGTATAGTGATATCCACAACAGCACTGCTCTCTCCGACCTAATACGTCGGAGAGGTAGCTGCGAGAGC
TTTACTTGTCCATCTACTCTCTGATTGGTTATAAATATTGCCTTTGTTCAATTTGACTCGCTAAAAAAGGGTTTTATATCACTACGATCACACTATTGGT
CAATCCAATCAATAATTTATTCAAGTGCGGTCAGAGATTTAATTTTATCTATATACAT