Description :
From Genome Similarity Track
Location :
Scaffold_1752:2224- 5164
Sequence
2940 bases(100 bases per row)
CTGGGTCGGTCGCTCTCGCCACATACATTCGAGAGAGTATCCAGGCGATCCGAAAGCTCCGCCGAGACATCTGGCTCAACCAGCTTGGGGTCGGAGTTCG
CCTCGGTCTCGGGAGCCAATCGGAGAAAATCCAGGACATCTGGGTCGACAGTTTGCTCTTCTGCGGTCGAGAGTCGCTTGAAGCCCCAAAGGGTGTTGTC
TAGACACTTCTGGTAGATCAGAGGAGCGTTTTTAAGCCCAAACGGCATACGCAGCCACTGAAAATGACCCAGAGGGCAGATGAAGGCCGAGATCAGCCTG
GCACGCAACGTCATGGGGATCGCCCGAAGCCGGACGCCATATCTAGGCTGAGAAATCACCTGACTGAATCAAAATTGTCCAGAAGCTCATCGATGAGAGG
AAGCGGATAGTTCATCAGCTTGGTCAGCAGATTCACAGCTCGATAGTCAATGCAGAGTCGGATATCTGCACCGTTCTTTTTCAGCACAATGACGATGGGC
GACGCCCATTCAGACGACGAATACTCGATGAGTCCGGCTTCAAGCAGGCGCTTCAGAAGCTCGTACACCTTGGCGAGCAAGTGACCAGGAATCCATCGGG
CACACTGGGCGACGGGCTTTGCGTCACCAACGTCGATGTCACAGATCGTTTCGCGCGCAGGCGGCGGGAGAGCATTGCCATGTCCGATAAAAACAGTCTC
GTGTCGATGCAAGATGGCCTTGAGGCGAGCTAATTCTTCCGGGGTATTCTCATCNNNNNNNNNNGCGCAACTCTTTCAGGACGATCTGATCTGATCCTTC
GTGGTAGAACACTGTCTCGGCCGGCGCGTCCTGGTCAAGTGTGGCTGACACTTTGTACGTCCACGCTAGCTGTTTCGCTGGGCTGGCCGGGGGCCGCGAT
TGTTCAGCTGCCATCTCAGCAGGTTCTGGCTTGTCGACACGATCTGGATCAAGAGCAACTAAGGGATCCGACTCCGTGAGACGAATGTCGTCCGGTTCGG
ACGCCAGCGAGTCATCTGGACCGACTGGATGGCGTATCGGAGTAGTTCCGTGTTTGCCAAGAGTTGGGGTGACGCTATGGACTTCCAGATCTTCGTGCTT
CTTCATCAACCCGTCAAACTCTTCCACGACTCAGGTGCCATAATCTTTCTCGTCAGCGGTTGTATCAGCTGTCACTGGGGTGGGGTCGGCCGCAACAGGC
TTGATAGAATCTGGTTCTGCGGAGCTCGTGTAGACTTCAGACTCGTGCTGTCGTCGCTCATCGAGTGTGCGGACGTGCTCGTCGGGGTCGGGTAGTGACG
TCGAGTGCTCCCCAGTCCGCAATCTGGCACCGGCCAGCTGGGCAGGCATAGCGTCAGGGGGACGTTGGAGGATTCGAGTTGGCGTNNNNNNNNNNTGTAG
CGAGGCCGATAGACCGCCGGTGGCAGGCTCTTGTTGAACATATAATCGGCATGGTCGAGGCGACGACGGTACTGGCGCGAGTGAGAAAACTCGAAAGTCA
GCTGCTGCCATTCGGAATATCGCGGCGATTCGACGCGAACGAATCCGCCTTTCTCGGGTAGATACCCGTGCTCCACCAATCTGGCTACGCAAGTGCGTCG
CTGGATGGTGATCTTGCTCTGCGTCAGGTTGTAGACACGGACGCCGACTGGAGCGGACGAGCCGTCGTCTGAAAAGCTACCGCAACCCAATCTCGACCCC
GATTCAGCCAGAGCTCGAGGATATCTGGATTGTACTGGCCGTACCGGACCGGCACCGTTACGGTGTCGCCAGGCCGAATCGTGACTTGTTCCTGGACGAC
GATAGGGACATCTAGGCCAAAACGAGGCCGATCTGGAGTGCCAACTAGCGGTATGCGTTCTTCGCCTGGCAGATGAACGTTCCCATCTGTTGTACTAAGG
CGCACACCTGCCGCCACCATGAAGTTCATTCCTAGCAGGCAGTCGACTCCTTCGCCGATGTTTCCAACCCAAATATCGGTATAGTACACCGCGTTCAGGC
CGAGAGTGATCTTCACTGAAGTCTTCGCAGTAATATAGGTCGTCACGCCACCGATCCCTTTGACTTTCATCCGGTCTCCATGAACAAGCTTGAGCTTTAA
CCTACGCGCAAGGTCTAGGCTCAAAATGCTCGTCGTGGATCCCGAGTCGAGCAGGATGGTGATGCGATGGTTGCACACTGCTCCGCGCGCGGTTGCCACT
GCGTGGTTATCGGTTCGATCTGAGTGCCGCGCCCACCGGCCTCGCCGCTCTCCTGGCTGAAGCTGGAACGACTGGCGATAGCTGAAATCTGGGTCGGGGT
CGGATGAATGCATCATGCAGAGGGCCGAGGCAGACGAAGACAAATTGTCGGTCGTTACGGCAAGACTTGGCTCATTACCATCGTTACACGCAGCGGCGAT
GCCGGTAAATGCAAAAGCGCTAACGCTACGGGATGCTTGCTCGTCGCGTACCGGACTCCCATCCGGCGAGCTTGCTAGTTTAAACGCAGCGCGTTCAACT
GTTGTAGCATGCTAGCTGGCAAGCCAGCTGAGCCATTTCCACGCGCCCACTTCTTCAAATCTTCAATCACTTGCTTGGCCGCGCACTTGCCGCGCTCGTG
GATCTTGTCACACGCAGGGCACTTCTTCCAGCACACCTCTGCGGGGTGGCCGATCGAGCCACAGTCGACGCAGACTAGCTTGGACCAGCGCTCGTTCGCG
ATGTGGCCCGGCTTGCCGCAAGTCTGGCACTTCAGATCACGTCGCGGGCTAGCAGGTGGATCCAGGTTGCGCGAAGGAGGGGTCGATCCAGGTCGACCAG
GACGAAATCCAGACAGCCTGTTCGGAGCTGACTTTGGTTCGGAGTCGCGACACCCTGGTGGCACACCAGTGGCCTGATACACTTCGGAGTCCAGCTCTCT
ATCTGGCCAGTCGTTCAAGCCGGCATCTGAGTCGACGTCG