Description :
From Genome Similarity Track
Location :
Scaffold_908:2224- 4650
Transcript NameFunction/comments
g12455.t1hypothetical protein

Sequence
2426 bases(100 bases per row)
TTACCTGAAGAGTGCCCGTCACTCTTCCGGGTTGGGTATATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACAT
ATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAA
CCGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACA
CTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAG
TTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCG
AGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGAAAACCAGT
TCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTACGGACGCG
GCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCTCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGTGAAGCGACAACGCCTG
GATGCTTTGCATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCCTTGCGTGCAA
GCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTG
TTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGGAGT
ACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGAT
GGACCTGAGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGG
TTTCCTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGG
GGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGA
GGGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGG
TCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCC
CAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATG
CCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTTC
CCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTC
CACCGCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTAT
GGCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGG
TCGAGGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTGGAGTCACCACCGGCTGTGGGTAA
CAAAGGACCATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAG
AACTCTCCTCAGGCACGGCCGGCCGA