Description :
From Genome Similarity Track
Location :
Scaffold_23:222361- 226626
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10794hypothetical protein
Phypa_INRA-310PPTG_10795hypothetical protein

Sequence
4265 bases(100 bases per row)
ATCTTCCAAGCAGCACTGCTGCTACAGGTGCTCCAGTGTGGCGCCTCCGTGAATGGCGTCGAGGTAAATGAAAACTTTCAGAACACTGAGCTCACATCAA
AGGACCAGCTGGGCACCGTTGCTCCGGCGAATATCCCGGACTCACAAGACGAGAATATTAAGAAGCAGGAAGAGCGTGGCTTCTTCGACTGGTTCGGCAA
TGACGATGAAACCCCGGCTCCGGCTTCGCCACCCTCAGGCGCGACCCCGGCTGCTGAAGAAACTTCGGGAGAATTTGCAACTACGACGCCGATCCCCGGC
ACGGCTGCACGGCCGTCCACCAGTAGTCTGATGTCAAAGTACGGTAGTATGCTAGGAGAGTTCACAAAAGACACCGAGACTGCCTCGGAAGCCGATGGAA
GCACGGCGGGCGCCGGTAGCTCTGCCACTACCCCTAAGACAAAGAAGACGAAGAAGCCCGCTGCCGCAGTGACCTCCACATCGTCTTCAGCCAGTACCTC
TGGCAGCGATGCAGCTGAAACTACACCGAAGAGGAAAAAGAAGACAAAAAAACCTGTGGTGGCTGCCTCCGCGTCTACGTCCGCGTCAGGGGGCGAAGAG
AGCGAAGATATCGAAGACAGCGGTTCTGGAAGTGACGCGCCCCCCAAGAAGAAGAAGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGTCGTGAATGC
CGTCAAGTCGCTTATTTACTATCTGCGTTACAAGCAGACCACGATCCCGACGACCGACACAGAGAAGCTGATGGACAAGGCCTTCCAGTTGCAGATCGTC
ATTCTTGACTTGCCCCTGGCTATTTGCTCATGCCTCGGCATCAAGATCCCTCCCAAGCTTCAGTTCTCGGCCACCATTCTGGCTGTCGTGTCGGCCATTG
TCATGATGGCTGTCATGATCGGTGAGACCATTTTCGCTTCTTCGAACAACGTCATGCTCATGCTTCGTGAGTCGGGCGCTCTCAACACTACTGCGCTTAA
CGGCGACACTATCGAGCTTGACACGTTCCTCAACACTAAAAACGGTACGTGTGGCTACGAGATGAGAACCCTCACGAACCGCGTCATGGGCAAGGTCTAC
GAAATCCGCAACAATACGCCCAATGCTGCTCAGAATGATGTGCGCGTCGAGGTGAGCAAGTCGCCCATCATTACTGATGACATCCCTATTGTTACCAACC
ACTGCATGGGTGAGATCTGGACCAACAAGACGAGTGCGTCTTCGTACAAGACCCGTAACCTGCTGCGAAAGACGATCGGTGTGATTGTTGACCAGCTGAT
TGAGGACGGCACGACTGACATGGGCAAGTCCGTGACCAAGAAGGAAAAAGCTCTCGAGTACTCGAACATGGGTCTCTTCATTCTCTCCATTTTCGACCCT
ACGGGTATTGCCTGGATGGCTTCCGAATTCGTTCAGCCCATTTGTGGTCCCACCGAATACCTCGGAGAGATCGACGACGGCACTCTGTACGACGCCCTGG
GTTTGAACACTGTTGACCAGGCATTCCTGGGAAGCTACGGTGTCTGGAAGAAGAAGGGTGATGGCTCCGTCACGGTTTACTTCGAGAGTGTTGACAAGTA
CGATGTGTCTGTGGTGATTAAGTCTGGTGGTGACAAGCTCAAGGAGGTCAAGGTGCCTGCTAACGGCAACGTCACGTGGACGTCTACGGTAGAGGAGCTG
GGGGACAAGACATTGTACCTCGATCGCTGGCGCCCTGGTCTCTTCGGTCTGCCTGGTACGGGAGGTGGTTCCCTACTGCTGTGGATTCCGCGGTCGTCTG
AGGGTGGCCAGCTTATTCTCCACGCGCGTTTGAATGTTAGCTAAGCGGATTCATCATGTCATTTAGCGTAGTGGGCATTTCTCAGAAGATATGAGAAAAG
TTTGTTCACATGTTTAAACGAATACATCAGATTATGTGGTCATGCGTCGTGATATAGCATATCCAAGTAGAGTCGAGTTGATACCGTAAATCACGGCAAA
CATGCAAAGTAGAAACATAGTCAAAACCTAAAAAGCTCTCGTGGTCGTAAAAAGACAACCAACTACAGACGATCCCCTCGGTAGTCATAGCGTTGGTAGA
CCCGAATTTATTCATGTCTAAAGGTATTTCTGTCCTCGAATGTACCACAAAATGGATCCGACTACCTTCAGTTTGGAATGTAGCTCGTTACTGGCGATTT
ACCCTGTTTTGCTCTTCTATTGCCAGTTTTGCCTCACCACACAAATATATCCTCCTCTCTAGCCCGGCCAGTCCATCTCACACTCACCAACACTCAACGA
CTGCTGTACAAATATGTTAGCACCATGCTCACATACCTAGTTTGTCCCAGAGCTAAATTCATAGGCTCAAAGAATCTACGGTCTTGGAAACTATTGATAC
GCTGAACAGCACTGGACTCACTTCCGGTCTCGCAGTTGGCCACCAAATCGCGGCACGAGGCGTGCGCCAGTTTACACCCGACCAGGTACTTGCCAATTGT
ATTTCGTGGGGCGAAGACTCTTCAGAAGAGGGTGTTGTCGTCACAGGTGTGCAAATTGGAGTGAATGTTGAGCATTTCTCCGTGGTCCTAAAGTTCGAAT
CACGTCCAAAGTAGTCTAAATAGGCTTTCATCGGTTCAACATTCGGATCTGACGTGGCAGCAATAATGCTCTTGTATAGTTATGACTTTACCATAGTTAA
GCACCCCAGAATAAGAATATTTGACTTCAAATTTATTCCATTTTACTTTTGAGGGGTGAGAGGGAATAATATCTTGGGTTTGTAAGGGACTGGTCAACAG
GAACCGCTAATTTATTGCTACTGGGGGAGTATTCCAAGTCTTTGTTGATTGGTACAGCCACACTAACTTGATGGTTTTCAACTCAAAATCGACTTTGAGC
TTCCACGGTAGGTTTTAACAGGCCCCCCGCTTAGACCGACAGCGAACCTCTGGACATCTTGGATCCCGAAAAGGAACGAGGAGCTCTCGCGACATTTTTT
TATAGAAAAATATGTCTTTCCTTAACAGAGGTACTTCTCGCCCGCTTCAAAATGACGTTTATATA