Description :
From Genome Similarity Track
Location :
contig_62:22233- 24129
Transcript NameFunction/comments
g11389.t1hypothetical protein

Sequence
1896 bases(100 bases per row)
TCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGAC
CAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCAC
TCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCA
TCCCTCGCAAGGATGTGTTGCTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCG
CGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGCCTATCAAATGCCCCAGCGACTTTCAATCGC
TTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCG
AGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAA
AGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTT
CGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACT
GGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCGGTCCTGGCTTTGCCGGACGAGACAAAACCGTTCAG
CGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTT
AAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCT
TTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAA
CTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCCGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACA
GATCTGTACGATCGGATACGGCTAGCGTATCGAGATGATGAGAATCTCTCCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGCCAAGCATGCATGGCT
AACGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGATCCGGCCGATCCTCCGCGGATAGTCGTCCCC
AACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAGG
TCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGCCAGCGAGTGAAACCTGCTGGTCATGCCTCGGCTCCTTT
GCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT