Description :
From Genome Similarity Track
Location :
Scaffold_100:222298- 228003
Sequence
5705 bases(100 bases per row)
GGGAGGAAAAGAGTATGATGGGAGCGTACGGACCACGGGAGATGACTGAAATATTGACACCCCACAGTAGAGCCCGTAGCTGTGACAACGCACGGAAAAA
GGATTATTCTGTTACACGACTGTGAAGCACGGTCGACGGACCAAACATGATTTCGCGGAAGTTCATAAACGGGAGATTTCCGAGCATTGAAATACCATAC
CAGGGTAGAACTGGAGCTCACCAAGCCACGGAGAGATATACTACGGTAGTCTACGATGGAGCGGACGACATACCAACCACGATATCACAAGATAACACGA
TAGTATGGACGGTTACCCAGCTAATAAACCATGAGAGAACGCGCAGTCACGGGAACTATAGACGGATAATCACTCAGCCACGGAGCACGATACCACTGAA
GAACTGAGCTCACCGAGCCACGGAGGACGATATTACAATAGAATATGATAGCACGGACGGCGGACCCACGGGGGAATGCTTCAAGATAGCACGAGGCTAC
ATCATGGAGCACGATAGCATGACCTGATACCGTAGTCAACAGATTTACACTATGAGTTCGCGAAAGCATGGACAGCAGAACAACACCGCGATTGCACAAT
AGCACAATAACGCGGTCGATGAACCCACACCAGGAACGCACGATACATAGGCGACAGATCAACACAGCTACGGAAAAGCACCCATCGGCGAGGGTACCGG
TGATGGAACGCCATGGACAATGATGGATTATGGACCACAAACCTGTGGAGCTCACGTAAACCCTTGGGAGCACGAAATAGCTAGCAGCTACGAAAGGGGG
GGGGGTACGAGAGAGCATGAAACCAAAGCGATAACGCTTACCCACTAAGCGGTTTGAGCTACGGGTGAGCTTGAAACTACGAAGCAAGGAAGACCACGGA
AGAGCACGACATCCAATCTGTAGTACCTACAAAACCACGGTATCTTACACCGCCACATGAGACTACGGAATGGTAGGGGATTTAAATCACACAACTACGT
CGTACTGAGGCTGCTGAAGCCTTGAAATACAAGCTCCTAACCGAAGTCATGCTGCACCATCAAATATTTAAAACTTCCGGACACCTCACATCTAACAAGT
CATGCAATCTCCGCCGCTAAGCGGCGGCGAACGGATTCAAGGCGCTGATCGTACACCCCGAAGTTGAGGAGAAGGACGGAGTTTACACTAAAACCTTAGT
GTACAGACAGATCGTTGAGCGTAGATAGGAATAATTGCTTACGGTTTCCACGTTATTTCGTTAACAAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACAGCTG
CGAAGCGGCGGCGCTCGGCTAGTCCTAAACTATTAAGGCTAGCACGGTGTCTGTCCGTCCGTCAAACGAAACGCTCAGGCTTTTGAGCTTTAACATTGGC
TGTCGAGCGGAGCAAAGGCGACCCTAATTGGTTAAAGCTGAATTATGTAGCTTACATCAGTACATTCATGTGGTTCACAGAGTAAATATGGAGATTCGCA
GCATCGTTTTGAAGTATTAATATTTATTGTTTTAGTAATGCATGTTGCTTTTAATATTTAGGGCTAAAAAGAGCTACTTACCCTCAAATGATATAGCCCC
TAAAGACGCTTCCTATACTGCAAGGTGCTTAGCGTACACGTAGGAATGCGTGTTTCCGAGGACATACAATTAAATACGTAATACTATGCTCTTAATAGTT
TCGGCAAGCCACAATGACTCAAATAATAACTACAACTGTTTTGTTGTAGAAATATTAAGAAAATATCTGAGTGTGAGGTAGCTGACTGAGCTGCTAAATA
ATAGTATATGTAAAACAGAAGCTGGCTGTAAAAACAACGCTGTGCTAATAAGCGTTGTCATATGATCCATAAAGATAGATACCGCGTTTCGCATGTAGAG
AGATGCACCCAAGGTTAACAAAGCAAATCAAACCTGGATAAATACATATTCAAAAGACACAATCAAATTATACAGGGAACCTTTTTCCTTTAGTAAAAGT
GTATATACACGACGGCTATATCAACACTCGCGTTGCCATCCTCCTCTGCGGTGAGCCATTTATCAAAATCTTGATCTTCGTCAATACTTGAACCTACTAA
CGATAGTCGCTGCAGCTCCTCCACCAAAGACGCAGCCGCAAGGCAGTCGGTGTCGAGACGCAAGTCGCACTTCTTGTACCCATTTTGGATGATCTCAGCG
CTCAGAGCTTCCCAACTGCTGCACACCCATCGGCACACCCCCGCGCTGAACTTTGATCCCTCTTCTCTTGGTTTTTGCAGTTGTTCTTGCAAATTCTCGA
GCCAGCACCTACGTAGTCCGCTTTTGAAAGAATAGTTCCATGCTACGTCTACCGGTTGACAGACAGACGTAGCATTTGGTGGCACCTTCATCAACACGAC
GTTGATTGAAGCAGCATAGGTAAGAACCTCTGCTGTCCAATGAACGCTAAAATTGTCGCAGAAGAGAAGCACCGGCTCCTCTTGGAACGATCGGCCGCCA
AAGTGGAACTTCAGAAACTTCAGCGATAGATAACTATTCCACCAGCCTAAATAAAAAATAATTAGCATCAATACAACTGTTAATAAAAAACGTTTTTAAA
ACACATAACTTTTGTATTCGTGTATATTTGCAATTTGGTCTCTTCTTGAAGGCGCTTGATTTCCGACCACGTTCTAACATCAAATCCGAAGCGCTTTTCG
ATATTTTCGTCATGAGTCTTCTTAATCTTGGATGGATTCATCTTGAAGATGACGAACGGGGTGTATTTAGTCCCGTCAGAGTCTCCCAGCAGCATTACTG
TAGCTCTTTCTTTAGAGGCTCCAGCACACTTCAGCCAAACGGTTTTGGCTCCGCGTTTACTGATCGTTCTCTTCACAGGCAAATATTCAAAAAAAGCAGC
TAGATAAAAAGTTAAATAAAACGTTTTAATAAAACCAAATAAAAATAAAAACGAGCCTGTTTCAGCTGCATTAAAAATGCGCTTCATACCCAACTGACGA
GCCTTCTTCTCGACTTCAATAGCAAATGCTACTTTTACCTTGTCAGTATCCGAGGGCCTGACTTGCCCTTGACGAGTAGGCATACACAGGCGGTGTCGAA
GTCAAAAACCCTTAATCCACTTATCTGAAGCTCTAAACCCGCTGATGCCAGCTTCCATGGCAGTCTGACGCGCTTGAATGGCTAGCATTCGAGGCGATAC
TGGTACACCCTCTTCCCTTAAGCAGTTCACCCACTCCACAATATCTAAATCTACCTCCTTACTCAGAATCGTTCCTACGCCTAAGCTCCTTACCTTTTGA
TAGCCACCTTTATTCTTCTTCAATGCTGACCTTAGTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCA
AGATGTTCGAGCGACGAACCCTCGGTCATGTGATGTACGGTAACGCCAAGGTGCAAGGGACTCGACGGCGTCACTACCGAACTCTCAACGAATATTGGAT
ACGGTCCATATGTCACTGAATCCAGGCTGTCCTTATTATAAATAATGGACTGGATTCAGCGACCAAGAACAGACCATCTACGGTACGAACCCTCGGTGGC
GGTTGGGATGAGTTCGCGGACGACTCAGCGACCCTTGGAAGGCACGTTCACTGTCTGGGACAGGGCGCGGGCCGTTAAAGATACTCATGCGACGGTGCAG
ACGACGCTTGGCATGCAAGAAGATCCATAACGGATCATTTTTCACTTGAGATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTA
AGCTTAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTC
GGTGAGCTCGAAGCTCTGTAGCGAGGGTTCATCCGGGAAGGCCAAGAGACTGTGTATTTTGGCCGATTATTATCGGGAGGTTTTTACGTGACGGCTAATT
GTTGCCTATTTGCACAACTGGGATTGCTTGTATTGCATTCTTTTTATTCTTCCAACAGAGTGTTGAACACTCGGTGACCTCGTAAAAGGCTTACCCGTGC
CTGGTACCCTTCCGCTGTTGGGACCACGAGGATTCATAACACATACTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATATAA
GTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGAAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCTTAGTAGACGTATTGTTGTG
GGAACGTCCTAACTACGTTTGTAGCTAGAGTTCACGTGGGAATTCCAACACCACAACTGGTGCCGCGACCCGGGAACAGATTGTGACCATTGTGAACTGT
TTGTATGGCCTTCCAGTTTACGAGCTACCAAGAGAAGAAGAACAAGAAAAAGACAAGAAACATGGCGAAAGGACAACCGACGGTACCAGTTACGCCTGCC
AGGTCTAGCGGGGCTCGCAACGAGAGTTCAAGCCCGGCTGCGCGCTTTGCAGCCGCCACCGAGCTTTCAGTGAGCTTCGACGACGAAGCGGACATCGGCC
CTGACGCCCACGATTATGAAGATTACGAAGATAAGACGCCGGCTCCAGAGCCAGGCGCAACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCCTCTCCAGAAATGATACAAGGAAGGTGTAGGAATGGG
GTTTTGCCTCTGTTGGCTCAGAGGGGGAAGAGCAGTCTTGTATTCTCCACCGACGATCCAAGATGAAGATCCGTCTAAGATTCCACTGCCGCCGACGCCC
CAACGACTCGTTCGTACTCCTCCGACCAAGCGTGGAGCTGAGCGTGGTGCCTTTGGCACTACCGAAGCTTCACCGTACTTTCAAGACATGCACATGGTTA
CGCCACGTTCGAGAAAGAGCCGAATGCAGGGTGTTTACGCCGCTAACGAGGGTTCGTTCGGTCGCCGGGGCGGTGCGCGAGCTCCGAAATATGGTGCCGG
ACGTCGTCAAGTCGACAGCGACGGTTCGTCCAGTGACGATGACATTTTGGTGCGTACATTCGACGAGGAAGACCCTCAAGTCGAGTTGATGCGTCCGATG
AATGAGCTGGCGACGCTGAACGACGTGGACCCGACACCGAGGATTGAAATGGCATCGCACCGACCATTGGATCGCATCACGCCGTTCTCAGGCTCTCACA
ACAAG