Description :
From Genome Similarity Track
Location :
contig_54:22221- 24235
Transcript NameFunction/comments
g9124.t1hypothetical protein

Sequence
2014 bases(100 bases per row)
GTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTT
CGAGGTGTTTTCACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGACGCACCACAGTCCACTAGTTTAGCTAGGTTCTGCG
TAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCCTTTGCCGATCGACAGAAGCTGCTGTTGC
GTCCTGGACAAACCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGC
CCGGCCTGCGCGTGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGA
TACATTGCTTGTATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACG
CGTGGGTGCCTCAAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGGTGGCGAACTCCGCCATCGGCAAGCAGTCGCTCC
ATTGATGGAGCGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACAT
GGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGAGAGTACTCGGATACTCTCGGAAG
AGATAGGCCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGTGTTGGTCACGATGTTCGAGGCCAAGTACC
GTGCCCCTTGGGCGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTTGATCGGAACTCGTTCTGCGGGGGCTCAAACGCAAG
TTTGAGCTTCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCATACGCCCAACTCCTCGCTCGTCCGCCAAGACATGAC
ATGGCGAACGCAACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTC
CAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGAT
GAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACGCCGCTTCCCAATGACTGTTGACAGTCGTTGGAGGGCCTC
CCACTCTGGTTCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCT
CAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAA
GCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAAC
CGAACGATAGCTTTGATGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGT
TGGCAGAACCCCTACCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAG
TGGTCACCTGAATG