Description :
From Genome Similarity Track
Location :
Scaffold_141:2222- 3885
Sequence
1663 bases(100 bases per row)
GGATAAAGTTCGGCCAACTAAACTAAGTGGTTGTTCTTATGGTTTACGACTGATTACTATGGGGCTTCAGTACCAGATATTATCGGTGTAAATATTCGGT
GCGGTATTCTCGAAGATCGAACCAGGGTCGTCGCTCTCAACCTCCACAAGTCCCTCGGTTGGATATTCGCTCAACTCTTGCACCATGAACGATGACACCG
TGAGGTAGAATTTGTCTTCCTTTTCAAATGAAAAGCTGCCTGATGTATATCGGTCCATCTTGACACTAGGAGCGACACAGCCAGCATGCTTGTAAAACAC
GAGATGAGCTCCTTCGGGTAGCTTCTTCCACGTCGTTCGAACAGCTCGGTCGTTCCACAAATCTTCAAGCGTATAGCATCGCTGAACGGTGTCGATGGTG
AACTTGGCGTTGCTACCTCGACTGTACAGCCACACTTCCATGGCCTTAGCGCTGTAGCAAAGCAGCAAAATTGTTATCAGGAACGGGAAGCTCTTCATTG
CGGTTCCGGAGGCTACAAGGCAGAAATCAAAGTGAAGCGTTTTAAACACGGTGCTGTGCTGGTGTAGCTCGCGGTACTTGACAACCTTTTGGAGCATTCG
AGAGTTCTTGTGCGATCGGTGGCTTATGTGGTGTGCTGTATCCGTCCGTTTTCTCTTAAATTTAATTTTAATAATGGATTCGCCGGCTTTTTTTTTAACT
GCCAACGCACCGCCAGCTGAAGCCGATCGTGCCGAGCTCGCCTACCATATCATACAGCTAGGCGCGGCCTGTGCTAAATACATATCTGCGATGCTGACTT
GGTGAGCAAAACATTAAATGAAATCGAAGCTGTAGCTGCCGATATTCGTACAAGTACAAAAAACATGCCGGTTTTGTATGGATGACTGTCATAGCATTCA
AGTTTACACGATGGATGGAGAAACATCTTTACTACAAATATAAAACAATCAGTAACGAGATTTCCCACGCCCTTGCAGATCAATAAACGTTGCCTGAATG
CCATCTTAATTCAAGAAATGCTCACCAAATTGCGTACCGTACTATTGCAGGATAAGAAGACCATACTAATCAATCAGGGCTCGGAAAAAATTATTATAAT
ATAATAACTGTGCAATTGTATTGACGGAATAATGGATTATTGGCAAATTGATCTTTCCGTAAAATATGCAATTGTGCCCGTAATATTTATATTGAATTTT
TACCCAACGTAAAAAGCAACAGAGAGTAAAGTAGTGGTTGTCAAGCATGCAATCAAAACGAATGGTTTGTGTGAGTTTGCCGGAGGCATCAGGCTGAGCT
TTCGTGCCTCTCATTTCTCATTTCGCCAGTGCCATGTCAACTTCTCGCGCCATCTCCAGCTTTTTCTTCACGGACTGCGGCAACGGGCAGTTTTCCTGCA
AGCAGTGCGGCAGGGCTCGCAAGCAGACGCCGGGGACTGGCTACACAAATCTCATCAACCACCTCGCAACGAGCCACCCCGGCTACAAGAAGACTTACGA
CGAGAGCCAGCGATCGTTCGGCCAGTCCCTCGAAGCACACGGCTTCATTGACCCGCGCACTATGGAGATCTTCAAGTGGATGGAGTGGGTTCTCGTCCGG
AACATGCCCCTGAGTGAGGTGGACGACGCCATGACGCGTGCGCTGGCTGCAATCAAGCCAGTG