Description :
From Genome Similarity Track
Location :
Scaffold_1546:2222- 3257
Transcript NameFunction/comments
Phymu_g13402hypothetical protein

Sequence
1035 bases(100 bases per row)
TCTCCAGGTCTGAGTGAACGCGATTCAGCCGCCGCTCGAAGTCATCACGTTCGACCCGGAGCTGACGAACTTGGACGCGTAAATCGTCCGGATCCGTCTC
CATGGAGCACTGAAGGTCCGCGATCTCGCTTTCCAGTCGTGTGATCTCGTCTCGCTGCCCACGCTGGAAGGTCTCCATGTTCTGGATCTCGAAGCGCAGC
TGTTGTGTCCGATCCTCCAAGCAGTCGCGCTCGCGGGTCAGCCGAATGCGTACCGAGTTCTGGCGTAGTTCAGCTTCCGCGATCAGCAGTCGTCGCGCAG
GCGTCGAAGCTTGAGACCGGCGAGAGGTGTCGGATCGGGGCGACCGACAGGGTGAGTCGGTCGGCGTTGGCAAGTGGCTACTGCCGTAGTCGCTGTCGTG
CTGGCTCATGGAGTCTTGATGTTGGTCCGCGGTGATCCGGGTCGTCGAAGTGTTGGGGACTTGAGGTCTTGCTTgaaaattggagaatgaaccCTGAAGT
GAACCCGGAAGGTCCAACTTGCAGGCTGGGggtggatgtggtgaagcacgaatacGAaactccgagaaaggcaacgcggaGCCTGTGATTGGAAGataga
gtcggatcgagcgacaggggacatactgagaacaagatccgaagtggaTGACCCCAGATCATGACATGGTAGCCGGCACAGGAAAGGTGACGCCCAAGGT
GATCCGGACTGCTAACGGGGAAGGAGGGATCAAGACCGATCGGACCGAAGGAAGgcgatctcgagcgacgggcgAGCAGCGAATCTGGATACCCGTTCGG
CGATCACCGTCACCAGCTTGGGACCGAGGGCAGCTTGAAGTGTCCGACTAAGATCAGGGTGGAAGACCGGCCCAAGATGGATACCTGAAGACTCCACGAT
CCGCGATCGAGACGCTGGCAGATTATAATCAAGTtgatcgagatcgacgatCGAGGGTTGGGGGAGATCAAGATTGAAGATCGAGTGATTATGCAACCAA
GTATGTATCCAGAtgtcaggtgatcgtagGATAAG