Description :
From Genome Similarity Track
Location :
Scaffold_339:2222- 3223
Sequence
1001 bases(100 bases per row)
TACTGTATAATACAACAAACCGGTTTGCCATGAGATTCCGTAACTTAAGAGGTGAATCGTCCAGCACGAAGAACAGATCCTTCGCACGAGCCTGTTCTTT
GGTGTGTGCGACTGATGAGAAATTCTCATTGAGAGGCCAGGGGATTTGCTCGGTCTGTGGTTTAACATCGTCATCACGTTCACGTGATTGCAGCAATCGA
GCCCGCCGGAATTTATGCAACGGTGCTCGACACCGCGAGATACTTCCTATTTGAGAAGAGCAAGACGCAGCGCAGCGCTCCGGTGTGTGCGGTACTTGGT
TCTAAGTTGACTTTGCTGCCGATGGTCGCGCGCAGACTGCCTGGCAGTCCAGCAGTCGAGATGCTAGACTGTGTCTTGTGTCTAACACGTAAAATCATCC
TTTCAGCTGGGACAGCCGAATAACCAACCGGAAGTCTGCTGCTCTAGAAGGTCCAGAACTTGAGGTGGGGCTTACGTCAAACTGCATCAGCTGGTGGTAG
GCTGCGAGTCCGAGACGAGCACAGCTGTACTTGGAGGCAAGCAGCAAAATCCATGCTCGAGAGGCAAAGTGTCCAACGCAGCCTTTGAGGGTGCTGAAGG
TAAACGAAGATAAGCGATGGCGGCTTTTTAAAATGAGAATCTCCTTCAAGTTTATCCTTTCTCATCCCAGGTGAGGGTGTGTGGCAAATCACCCACGAAG
GCGCATAGGCATCATGGTTGGGCATCTTCGTTAAAACGTCGTGACGCTGCACGACTAGAAAAATATGCTTTGTCTATCGATACTAAAGCATAGTCCCTAA
GTAGACTTGTCAAATACTAGGAGCCTAAATCAATGTCAAGGGCGCTTCACCACTGAGACTGGAGTTCACATGAGTCAAACGACCACCAATCCCCAACTGG
TCGTTATTCGGCGCCTTGAGCAGAAGGCGGTGGGGATAACATGTATTGTTGAGCACCGATGTGCTGTGCACGGGTGTGCCGGGCTGGCGTGAGATTTGCC
A