Description :
From Genome Similarity Track
Location :
Scaffold_23:222186- 225362
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10794hypothetical protein
Phypa_INRA-310PPTG_10795hypothetical protein

Sequence
3176 bases(100 bases per row)
GTGAGATTATCCGGACCATTATCATGGGAATACAGCTTGCTGGACAGCATGAGATTTGCCTTCACATTCTGCGTTTTTCCGCCTTGGACACAAGCCAGTT
TGTTACTTTCCCAGTGTCTTACTGCAGAACCCGAGACTGAGAGGTACAAACATGGTGCTTCGAGCGGTAAAGCTGATCTTCCAAGCAGCACTGCTGCTAC
AGGTGCTCCAGTGTGGCGCCTCCGTGAATGGCGTCGAGGTAAATGAAAACTTTCAGAACACTGAGCTCACATCAAAGGACCAGCTGGGCACCGTTGCTCC
GGCGAATATCCCGGACTCACAAGACGAGAATATTAAGAAGCAGGAAGAGCGTGGCTTCTTCGACTGGTTCGGCAATGACGATGAAACCCCGGCTCCGGCT
TCGCCACCCTCAGGCGCGACCCCGGCTGCTGAAGAAACTTCGGGAGAATTTGCAACTACGACGCCGATCCCCGGCACGGCTGCACGGCCGTCCACCAGTA
GTCTGATGTCAAAGTACGGTAGTATGCTAGGAGAGTTCACAAAAGACACCGAGACTGCCTCGGAAGCCGATGGAAGCACGGCGGGCGCCGGTAGCTCTGC
CACTACCCCTAAGACAAAGAAGACGAAGAAGCCCGCTGCCGCAGTGACCTCCACATCGTCTTCAGCCAGTACCTCTGGCAGCGATGCAGCTGAAACTACA
CCGAAGAGGAAAAAGAAGACAAAAAAACCTGTGGTGGCTGCCTCCGCGTCTACGTCCGCGTCAGGGGGCGAAGAGAGCGAAGATATCGAAGACAGCGGTT
CTGGAAGTGACGCGCCCCCCAAGAAGAAGAAGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGTCGTGAATGCCGTCAAGTCGCTTATTTACTATCTG
CGTTACAAGCAGACCACGATCCCGACGACCGACACAGAGAAGCTGATGGACAAGGCCTTCCAGTTGCAGATCGTCATTCTTGACTTGCCCCTGGCTATTT
GCTCATGCCTCGGCATCAAGATCCCTCCCAAGCTTCAGTTCTCGGCCACCATTCTGGCTGTCGTGTCGGCCATTGTCATGATGGCTGTCATGATCGGTGA
GACCATTTTCGCTTCTTCGAACAACGTCATGCTCATGCTTCGTGAGTCGGGCGCTCTCAACACTACTGCGCTTAACGGCGACACTATCGAGCTTGACACG
TTCCTCAACACTAAAAACGGTACGTGTGGCTACGAGATGAGAACCCTCACGAACCGCGTCATGGGCAAGGTCTACGAAATCCGCAACAATACGCCCAATG
CTGCTCAGAATGATGTGCGCGTCGAGGTGAGCAAGTCGCCCATCATTACTGATGACATCCCTATTGTTACCAACCACTGCATGGGTGAGATCTGGACCAA
CAAGACGAGTGCGTCTTCGTACAAGACCCGTAACCTGCTGCGAAAGACGATCGGTGTGATTGTTGACCAGCTGATTGAGGACGGCACGACTGACATGGGC
AAGTCCGTGACCAAGAAGGAAAAAGCTCTCGAGTACTCGAACATGGGTCTCTTCATTCTCTCCATTTTCGACCCTACGGGTATTGCCTGGATGGCTTCCG
AATTCGTTCAGCCCATTTGTGGTCCCACCGAATACCTCGGAGAGATCGACGACGGCACTCTGTACGACGCCCTGGGTTTGAACACTGTTGACCAGGCATT
CCTGGGAAGCTACGGTGTCTGGAAGAAGAAGGGTGATGGCTCCGTCACGGTTTACTTCGAGAGTGTTGACAAGTACGATGTGTCTGTGGTGATTAAGTCT
GGTGGTGACAAGCTCAAGGAGGTCAAGGTGCCTGCTAACGGCAACGTCACGTGGACGTCTACGGTAGAGGAGCTGGGGGACAAGACATTGTACCTCGATC
GCTGGCGCCCTGGTCTCTTCGGTCTGCCTGGTACGGGAGGTGGTTCCCTACTGCTGTGGATTCCGCGGTCGTCTGA