Description :
From Genome Similarity Track
Location :
Scaffold_47:222164- 224204
Transcript NameFunction/comments
Sapdi_VS20SDRG_12180hypothetical protein

Sequence
2040 bases(100 bases per row)
GCGACGCTCCAGGACGTCGGCGTCGAAGACATGTGCTCGCTCAACCATCTGCACGAGCCAGCGATCGTCTTCAACCTCCGCACGCGCTTTGCGGTGCAGT
GCCCGTACACGTACACGGGCAGCATCGTGGTCGCGATCAACCCGTACGCGTGGCTCAACCTCTACTCAAAGGAAACGCAGCGGCTGTACGCTGGCGACCG
CTCCGGGCTGCCGCCGCACGTCTACGCGACAAGCGCGGCCGCGTTCGAGTCGATGGCGCTCTACGACCGCCCGCAGAGTACGACTCGGATTCCATTGCCC
ACTGCGCTCACATTGCATTGCATCTAGGTATCCTCGTCAGCGGCGAGTCGGGTGCAGGCAAGACCGAGACCGTCAAGATCATGATGGAGCACCTTGCGAG
CCTCAGCACGGACCCAAACATGAGTATCATCGACAAGGTGCTCAAGTCCAACCCGCTCCTCGAGGCCTTTGGCAACGCCAAGACTGTCCGGAACGACAAC
TCGAGTCGGTTTGGCAAGTTTACGCAGCTGCAGTTTGACGCGGACCAGCGCATGGTCGGCGCAAAATGCCGGCACTACCTCCTCGAGAAGTCGCGCGTCA
TCGGCCAAGCCGAGTACGAGCGCAACTACCACATCTTCTACCAGCTCAAGGCGTCAAAAGAGCCCGAGTGGGCCCTCGCCGAGACGACGTTCACGTACCT
TCGCGACGATGCACCGCTGCTTCTGGACGGCGAGACGGACGCAACACGATACCAGACGACCCGTGACGCGCTCTCGACGATCGGCGTGTCATTCGACGAG
CAAATGGCGCTGCTCAACGCCCTCGCCGGCATCCTGCACTTGGGCCAAGTGGCATTTGCGACCAAAGCCGAGAACGCCGAAGAGTGTGCGCCCCTCACGT
CGTCGCCGCACTGGGCGCACGCGTGTCGCCTGCTCGGGTTTGAGGTCGACCCGACCGCCTTGGGAAGCGCGCTCTGCAGCCGGACGGTCAAGGCGCGCAT
GGAGGTCTATGTCGTGCCGTTGACGATCGACCAAGCGACGGCCAACCGCGATGCACTCGCCAAAGAAGTGTACGCGCGCCTCTTTGGCCACCTCGTGCAG
CGGGTCAATGAGAGCATCTCGAACGACGAGGCCATGGTCGGTCACATGGATCTGCTCGACATCTTTGGCTTTGAAGCGTTCGAGACCAACCGGTTTGAAC
AGTTTTGTATCAACTTTGCCAACGAAAAGCTCCAGCAAAAGTTTACCCACGACGTCTTCAAGAGCGTCCAGGACGTACGTCACGCTTGATACGTTGATAG
TATTTGTGTTGTTGATGATATATGATAGGAGTACACGCAAGAAGGGCTTGGCTGGACGTACGTGAGCTTCCGCGACAACCAAGACATGCTCGACATGCTC
GAAGCGCCGCTCGGCGTCATCTCGCTCCTCAACGACGAGTGCATTCGACCGATGGGCAACGACCTCGCGTTCTGCTCCAAGGTGCTCTCGACGCATGACG
CAAATCCGCGCTTGGACAAGCAGCGCGCGCGGGTATCTATCCATCTATCCATGTATCCATCTATCCGAATCCTCAAATCGATCGGTAGCTGAGCGCAGCG
CACTTTGCGTTGCGGCACTATGCAGGCACCGTCATGTACCACGTTGAAGCGTTCGTCGATACCAACAAGGACGCGCTCTCGTCCGATGTCCTCGCGCTGC
TCGGCGCCAGTGCCAACACCATCATCGCCAGTGTCTTTGAACCGGCACCGATCAAGAAGCCGAGTGTCCTTGGCGGCCGCCGCCAGTCGACCGCGTCGTT
CATGGGTACATGCTCTCTCGATTCTTCTTTTTGTTTCAACTTGATATGTTTAGGCGAGACGGTCATTTCCAAGTTCAAGGCGCAGCTCACGGGTCTCATG
GCCGACATTAGCGATACGCAGACGCACTACATTCGGTGCATCAAGCCCAACAGCGCAAAGTCGAGCACGCTCTATGACGTGCCGGGCGTCATCGAGCAGC
TGCGCTGCGCCGGCGTCGTCGAAGCCATTCGCATCTCGCG