Description :
From Genome Similarity Track
Location :
Scaffold_172:22214- 24996
Transcript NameFunction/comments
g6222.t1hypothetical protein

Sequence
2782 bases(100 bases per row)
GATGAGGTGGATGTCGTGCGCAAGGACAGCGACGGCTGGTGGTTCGTCATCAAGGACGGCGAGAAGGGCCTCGTGCCGGGCTCGTACCTGCACATCGAGA
ACCCCATTATCCCCGTCACGGATGCGGCGATCCTCGCGGCACGTGAGACCTCCAATCAGCGGTTCATGGAGATGCAGCAAAGCTCGGGAGCAACTGGACA
GGGTGCCGAGCCGGGAGTGGAATACCAGTCGCCGCTGGGACTCGAAGCGCTCGCGATCGCAGACTCGTGCGCGCCCAAGCCGCCCAATGGGCCTGCCCGC
GCTGATGCCAAGTCTGGCGGCACCGAGTTTAAGCCGGGCGAAGTGCGCAAGTTGAGAAAATGCTACGCCTGCAAGGAGACGATTCTGGGCCGCACGAAAG
TGTGCAAGGACCAGATATTCCACGAAATCGTAAGTGGCAGTGGTCGGCTTGCTTAAAACACAGTGTGTATGCTGATTGCGATGGTGTTTATACAGTGTCT
GCTGTGCAAAGGCTGCCGCGAGTCGATCGAAGAGGGCGAGGACTTCACCCTCATCAAGAAAAAGGTTCACTGCAAGCACTTTCTAGGGAATGCTACTGGC
TGAGCGCTGACCATTGTGTTGGAACTGTAGGCCTACCACGCTGAATGCGCTAAAGACGTCAACCACTGCATGGTTTGCGATAAGGTATTGCTCGCTGCTG
CAAGCGTTTCGGTGTTTTGCGAAAAGTTCTCACGTTGATGCATGATGTAGGAAATCTTGGGCCGAGTGTACCGAGCTGGCGATGGCGCATTCCACAAGCT
TTGCATGGTTTGTTCAGTTTGCAACAAACAAGCTAAAGAAGGTAAGCAACGCCGTTAAACTGGAACTGAAGGATGGTGGAGTGTGCAAGCGGATGAAACT
CAAATTTTGATGTTCACTTACCGTTTGACGTGACAGCTGGATCGAAGTTGGAAAACGACCTCCTCATTTGCGGTGAATGCGTCGCGGAGAAGGGTAAGCG
CATCTTACGGTGCAATGGCGAGTCGAACAATAATGCTAACAACTACAATGTGGCATGCTTGCAGAGAGAAAAGAGAGGGAGGAGAGAGAAGCCGCCCTCG
AACGTGAGCGGGCTGCTGCCAAAGCGAAGGCTGAAAAGGAGGCTGCTCTTGCTGCAGCACGCGCGTTGGAAGAAAAGAAGGAGCGTGAAGCACGCGAAGC
ACAGAAGGCTGTCGAAGACGCTGCGCGCGCAAAGGCTGAGGCAGAAGCCGCTGCGGCTGCGGCTGCTCGTGCCCAGGCTGAGAAGGAGGCAGCAGAGGCG
GAAGCGTTGCAAAAGGCTGCTGCAGCTGCTGTGGCAAACGGCAACGGGCGGTCTGGAACCGACAGTCTGCGATCCAGCACATCAAATCTTGATGAGTTTG
ATTTGGAAGCTACACCCATCGACATGTCGGGTCAGAATAATCGTATCTCGGAAGTATCGGATCTGGACTCGATTCTTAGCGACGGCGATTACGCTGGATA
CATGGGAAGTGGCCAACGGGAGTCGCTACGCTTGTCAGAGGTTCTAGACCTCGAGTCGTATGATGACCGTTTGTCCGACTTGAGCGGCATTTCAGAGGGA
GGTGCTGGTAGACCACGACGCTCCACAATTGAAAGGACCGTGAACGAAAACGCAGAGGCCTTCTCGGAAGATGAAGACGATCGTGAGCTGTGTGGTGGTT
GCGGACTTGTCCTGGAAGGAGAAGCCGTTGGTGCATTGAATCAGTACTTCCACTATGAGGTACGTGTTTGCACACTGTGGAGTTCATCATCTTAGAAATC
GTTTGACGAACAACCTATGCTGCTTGTGCTGAACAGTGCTTCAAATGCAGTCACTGCAGTCGTGTTATTGCGGAAGATGATGGCTATGCAGAGAAAGACA
ACCAGGTACTCTTCTTCTTGAATTTGGTACCATACCCTGCCCTGGAAACTCATCTCACATCTTGCTTATTGCAGGCTTTCCACCAAGCATGCTACCAGGC
TCGATTCGGAAAGAAGTGCCATCGGTGCAGCAAGGTTCTCAAGGGAAAAGTCGTCAAGGCCCTCGATCATCTCTACCACCCGGATTGCTTTGTGTGCTTC
AATTGTAGTGCTTCTCTTTCAGGTACATACCATAATAGCCCGCTGGATCGTATGTGTGAACTACTCAATACTAACACAGGGCGTGTGTGATGTTTTATCG
TCCAGCAGAGAGTTTCTTCGAGCACGAAGGTCAAGCCGTTTGCGCTAAATGCAAACACGAAGCAATTGCTTTGGACGAACCAAGCCTCCCGTATGTCGTG
TGCTTTCTGCTTTAACTAGCACTGCCTACCAACTAAATTTGTGTCATATGTTTTGCTCTGCAGAGAGAACGTGGCACCAGTGTCTAAAGGCATTGCTGGT
TATCGGTTCGACGCCCAGGATGACACACAATTGACTATTTATCCGGGCGACGAAGTCACTATCCTTCAGAAGGTTTGTTCATTTAGAAGGCGGCTCTTGC
TGTAAACGCTTCCTAACGTTGGCATCTTGCATTGTGTGCGACAGGACGACGATGGCTGGTGGCTTGTGGATTTGCGAAACAAGCGTGGTTACGTGCCAGG
CTCCTACTTGATCGAGCGCCCAATTGAAGAGCCAAAGCCCCAGCCGAAGAAGAAGAAGAGTGCCTTCAAGAGTAAGCCCAAACGTACACCGGGTCTTTGC
AGCTCGTGCTCGACGCAAAACCCGGCGGAGGCACGCTTCTGCCGAAGCTGTGGCAACAACCTGAAGGCCTAACTGGCGGATG