Description :
From Genome Similarity Track
Location :
contig_58:222138- 224175
Transcript NameFunction/comments
g8857.t1hypothetical protein PHYSODRAFT_565275

Sequence
2037 bases(100 bases per row)
GCGCCCAAGAAGCAGTATGAGCTGGTGGTGCAGGACGACTTCCTCGTGGTGCTGCACCCCGTGCATCCGCTGAGTCTGCAGATCGCGCGCTCGAGCGGCT
CGGACGCGTCGCTGGGGCTCGCCGTGGAGCACGTGGCGGACTCGCAGCACGTGCATGGGCGGCGCATGGCCTTCGACGCCATCTACGGCGTCTTCTGGCT
GCTACGCGGGCCCTACCTGGCAGTGGTCACGCAGTCTAAAGTGGTGGCCAAGGGCGTGGACGGCCACGAGATCCGCGCGGTGCACACGCTGGAGCTTCTG
CTTATCCCCACGCAGAACCTGCCGACGCTGACGCCGCAGCAGGAGCAGGACGAGCGCACGTACATCGACATGATCACGGGCGACATCGAGGCGCAAAAGC
TGCACTTTGCACGGGACTTGGACCTCACGCACACGCTGCAGCGTACGGCAAGTGGAAGTTGATACCTTTGGACAGTGAAAATGACGGTAGTTTACTGTCT
TGTCAGGCATTGCGGCGTTCGACGGCAGGATCGGCAGTATTGCCGAGCGCGCGGACGAGCGCTTCTTCTGGAACAAATCGCTGTGCTCGGCGTTCATTGG
TACGAGACGCTGTTGAGGGCTGGTAGGGGGATGAGACTGATACGTTGCGCTGCAGAGCAAAAGTTCTTCGAGTGGGTGACGCCCATGGTGCAGGCGCACG
TGGAGGTGACGGAGCAGCTCAAGGTGAAGGACAAGTCCTTCCGCATCTTGTACATCTCGCGAAGGTCGTGCAAGCGCCAGGGAATGCGCTTCACGATGCG
CGGCATTGACGACGATGGCAACGTCGCCAACTTTGTCGAGACAGAGCAGATCTGCATTTTTGACGACGGGAGGCAGACGTCGTTCGTGCAGATTCGGGGC
TCCATCCCCGTGTTCTGGAGCTCGCCGTTACGATGAAGTACGCGCCGAAAGTGTACCACGCCGGCGATAGCGAGCGCGACGTGGCGGCCTTCCAGAGGCA
CGCGTACCAGCTCATGGGGCTATACGGCCGCGTGTTGTTCGTGAATCTCATCGACAAGAAGAAGGAACAGCTCAAGCTAGGCGAGGCGATGGCCAAGACT
GTCGCCGACGCCGCTACCAAGGACTCGCACATCCTCGCGGCCGTGCGACTCGTTTGGTTCGATTTCCACCACGAGTGCCGCAACATGAAGTGGGGCAACC
TCGAGAAATTGATCAAGCAGGTCGACGACGACTTCCTCGACCACGGGTAAGTGCCATACCGCGCTTGGCGGTGGTTTATCAGAAGCTGATCGTGCGTTTG
TGCAGATACTTTTGCAAGGGCGCCGATGGCTCGGTCGTGAGCAAGCAGTCCGGTGTGGTGCGCACCAATTGCATGGACAACCTCGACCGCACCAACGTCG
TTCAGGTGCGTCGTTCGAAGATGTCTCCTGTTGAAGTCGACTGCTAACCGCCCCTTTGTCTCGCCAGTCGCTGTTCGGGCGGCGGAGCCTGATGTTGCAG
TTAAACGAGACCGAGGCGCTGCAAGGAAACGTGCTCAACTCGCCGTTCGAGGAGTTGGAGCGCACGTTCAAGCGCGTGTGGGGCAACACGCCGACGCGAT
CAGCCTCTTCTACGCCGGCACGGGCGCGCTCAAGACGGACTTTACGCGCACGGGCAAGCGCACCAAGAAGGGCGCGCTCATGGACGGCTACAACTCGTGC
GTGCGCTACATCATGAACAACTTCATGGACGGCTACCGCCAGGACGTGCTGGACCTGCTGCTCGGACGTTTCTCGGTGTCGCGCAGCAAGCCGTCGCCGT
TCCAGACGGCAGGCGAGAGCCTCGAGTCGGTGCTGGCCAAGCTCATGGGGCTCGTGGTCGCCTTGTGGAGACGTACCGCAGCAGCGGCCAGAGCTTCTTC
TTCGAGCGGCTCGTGCGGTCGGTGCTGCTGACGCTGCTCATCTGCGCGGGCGTGTTCAGCGTGCTGGTCAAGAAGGGCAACTCGCTGGGCCAGAAGCTGG
TGCGGCTGCCGAGTTTGCGCCCGCAAGACGGCTGCAT