Description :
From Genome Similarity Track
Location :
Scaffold_44:222132- 223239
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09410leucine rich repeat protein
Sappa_CBS223.65SPRG_09411PREDICTED: adenylate kinase 8

Sequence
1107 bases(100 bases per row)
CTCTCTGGATCAACGGCTCGTCGCACATGTATCTCGGTGGGTGCCTAGGTGCGCCACGACGGCTACTTGCAGCTGCGCGAGGCCGTCATGACCAAAGACG
AAGGCAGCAACGTGTACAAGAAGCGCATCCAGCACCTCGACGGCCTCGTACCCGCCACGGACCTCAACCTTGAAAATGCTTTTCACGACCGCGACAAGGA
CGAGGTATTTCTTGTTGTATGAGGTTACTTTCGTCGAAATTGCGTGGCGCTAGATTGGTCGCAAGATCCTACATGGCCGCAAGTAGCTTCGATGCTGGTA
CACCAGAATGTGATTTGTTTGCTATTTCTTGTGGCAATATACTTGTATTTATTCGGTCCTTCTGCGTGGTCCACCTTCACGCTTTCATCACTGTTGTACG
CCATTTACTGTTATCGTTTCGGCAAGACAAGGGGATCTCATCCGACTGGTGGTACAAAATATATGCATTGAAATCACCGCGCTTGCCTGGTATCGAAGTG
CCGATGTACCATTAGGACTGGCTAAAAAAAGTTACATGTTGTTAAGGCAGTGTACAGCATTCCACGTTTTCTCATATCACGCTACTGGCAGCGCTCTGTC
TGTTCTTTTTGCCTCTTGAGATGAGTGTTTTGGCCGGTCCATTTACAGGGTAGTTTCCATACTCTCTTATTTTTTCCTTCTTTTTTGCACGTGATATGCT
ACTACACAATATTGTCATATTCTTGCTCGTATATCGAGCCGCGAGAAGCACGATCAGGTACTCGCCGGCCCTATTCCATAGCACAATGAACCACGTACAA
CGAGAAGCCAAAGACGAGACGCACGTGCGAGGACGGCGAGGGCCAAAGTGCTCAAGTCGCGGAGGGTCACCTTGGGTGGCAGCACCTTCTCCGTCTGCAC
GACGGCGTTGACAATGTCGTTGGCGTGGCGTGGAAAGTGCTGGCGCAGGAGCTTGGAGGCGAGAATAGCCGACAAGAATGCTGCTTTGTCGTACGTCCGG
AGGTCGTCGTAGATGGTTTTGAGGAGCTTTTGCTTGGTCTTGATCGTGCGCAAGTCCATGCGGCTGTAGCGCGCCTCGTCGTCGAGAGCGATGATGGCCG
GGTCGTT