Description :
From Genome Similarity Track
Location :
Scaffold_151:22212- 24824
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.27Intraflagellar Transport Protein 140

Sequence
2612 bases(100 bases per row)
CTTGTCGCCGGCCTGCGTGTACTTTTTTGTCGCCAGATGATACGCGCCTTGCTTCTTGCAGCATTTCGCGAGCTTCAGCAGCAAATCGGCACGTCGTTTT
TGATGCACTTTGTCGCCCGCGGCAGTCGCATCTTTTTCATCCTTTGGTGGCGTCATTTTCTCCGCCATCTCCTCCGTCACCTTGACACCATGCTGCATGC
ACACATCAAGTGCTTCACTGATGCGATTTCCAATGAGACACAAGTGCACGGCCTTGGCGTAATGGCCGTTTGTGATGAAAAACTCAGCACACTTTTTCAG
GATAGCTGGCGACGTGTTCGACGTGCCGAGCTCATCCGTTAGGTGATGCAACTCCTCGAAGAGCTGAGCCTGAAAGCAAAGATCGAGTGCCTTGGCGAGG
TTACCACCCTTTTGGTAAAGCTGGACTGCTTTCTCCATTTCGCGGCGTCCCTCAAAGTACGCGGCACATTCGAGCATGTCGCTCGGTTTGCTCATGAGAG
CGAAACTCATGAGATCTGCATCCATGCCGTGCTCCTTTGCCAGTCGGATGGCATGATTGTAACATCCTCCCGCTGCAAAAAAGTGAATCGCACTTTGAAC
ATCATCATGGGCTTCGAACTGGCGCGCCAAGTGATAGGCTGCAGCACGGTTTCTGCTTGTTTTGGCGACTTTGGCGGCTGCCTGGAAATCTTTTTTGAAG
CACAGCACGCGGACAATTGACAAATAATCCTTGGCCTTTTCGTAGCATTCGATCGCGAGATCAAAATTCCCTTGACTTTCCTGGAATTGAGCCCACCAAA
TCATCAATCCACGGTCCTTCGACGTGAAGATGTACTTTTGCAGCAAATCCAACTTGTCCAGTTTAAACAGCATTCGCGGAATGTCCTTCAAATGAGTCCC
AGCGTCTTCATACGCTTCCATCGCCTCTTTGATCTCGCCCATCTCTTCATAATGCTGTGCAATTGCGTAATACGTACTCTTTAGGTGGATTCTGTCTCGC
TTGGTTGCGACATCGACAGCCTTTTTCCAGCACCCACTCGCTTGGTAAAGCTTATTCAGCAGATCGTATCGCCCGCACTCACGGTACAATCTTGCTGCAT
CGTCGCGCAGACCAAGCTGAATCGCGACCATGGCAATGGGGACTTCTAGCTCCGGCTGCAACGTCGCTTCTTTCACTGCAGCAGCACCGCGCGCATGGCC
CATGCTCCCCAAACAGATCTCGGCCACATCGACGCGCTTCGTTTTCACGCATGTGTGCGCCATATTCTCCCACACCGACGGATTCTCGATGAGCTTCACC
GACCGATATGCTTCGTCCATATTCCCGATCGTCACATAGTAGCAAAAGTTGATGAGTGCCTCGCGTCCCTTCTCGTCCACTTTGTCCAACCCAACGAAGT
CGCGCATGATCTTCGTGCACAAGAAACTCGACGGTTCATTACTTGCTGTAGCTTTTGGAAAGCTGCTCGCCCGGTCCTTCTTGCTGCCACATTTGACAAT
CGTCGTCGCATCGATACTGGAACTTTTCTCCACTTGTGCAACGAAGTAAACGCGCGGCGCCTGGATACCGAGCAGTGCGCTGAACTTCAACTCCATCTCG
TAATTATCTTGCATCAAGATGCCATGGTCATTCGACGCAAACATAATCGTGATTTCTTTGTCTGACAACGATGGACGATTGCTGTTGCCTCCAGAGCCGC
CACCTTCTTCAGAGGAAATGTCACGCCGATCACTCGCTTGGTTTCCTCCTGTTGCCGTCGCATCCGCCTTGCTCTTTGAGCTCTCACAAGCGAGCAAGCG
AGGTTCGAGTGAATCGAAAAAGACCGAAATCGGGTGTCGGTCTACGCCGAAGTCGTACTGCTGGAAGACGTTGAGATCGGTCTGGAAGAGGAATAACTTG
TTCAGTGGAACGCGGATCTTCAATGCTCCTTCCAATCTATCTGCTAGGATACAGATTCGAGTACCGTCAGCATTCACAGCGATTGCTCGCATGATGGACG
TCCTTGTTTCGTCCCCGTACGATTCCAGAAAGTTGCCCATGCTCCCTATAGCTTTGGGGTCACGCCGCGATAAATCGAATACACGCAGCATCCCGCGATC
GGTACCAACAGCAAGGAACTTATTCTGCAACGACAATAGAGCAGGGCATCCCTCTGCCTCCGTGAATGAGATTGCGTTCTTGACGACTCCTTGAATGTTG
CAAATCTCGACGTGGTTCCCATTTGTCCGGTAAATGGAGTCGCCTCGAACGACGACTGCTTTCGCATCACTCTTGAACTGGCCGATTCGTTTGTTATCAC
CATCCTTAATTTCGTACACTTCCACTTTCGAGCCATTCCAGATGACCACCGAGGACGAGTCATGGGACAAACCTTTGATCGGAAGAGAGGTTTCTAGCGT
AGATTGAGTCACGGTGCCGTCGCGGAATTTCTCGATGGAAAGCGTCTTGGGATGACTTTGAATCGCTGCGGTTCCTCCGCACAGCGCGCGCTGCATACTC
CCTTCATGCAAGATCACCACACCTTCAGACGTATTCGCATACAGCGTTGAATAGATGCTACTCCACCCAATTCGAGTGATACTTCGTCCAACCTCAGTTG
TGAAGATAATAT