Description :
From Genome Similarity Track
Location :
Scaffold_1028:2221- 8621
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1028-fgenesh-gene-0.3Translocation protein SEC63
Pytiw_DAOMBR242034maker-piw_contig_1028-snap-gene-0.6Zinc finger protein
Pytiw_DAOMBR242034maker-piw_contig_1028-snap-gene-0.9Conserved gene of unknown function

Sequence
6400 bases(100 bases per row)
GTATGCGCACGACGCTCCAGGCGATATCTACTGGTCCTTCTTGCTCTCGGCGTCAGCATCGGCGTCAATGTCAGCGTCGACTTCTCCTTCATCCTCGCTA
TCACTAGAGTCCGCGGCGTTCATGACCTGCTCGAAGAGCGTCGGCTCGTTATCTAATTCCAAATCTTCTGGGTGCGGTTGGTACACTGGAAGCGCGGCGG
CTGGCGTCACCGTGAACTGCATCATCAAGCAAGCAAACGCACAACACAATCAGCAACCATACCATATAAATCTCAAGAACGGAGAGACGCAACAGAAAAA
CATACCTTGGCGAGAGCGCGCAGGTCCAGGCCAATGTACGAGTCCGACTTGACAAAGATCTCGAGCTGGTATGTGCCGGCCTTGGGAGGCGCCTGGAGCT
GCAGTTTGAGCTCGCCCGTGCGCTCCTGGGATGTGATCTTGCCGAATGCGTGCAGGTGGTTGTTCTTCGTGTCGCCCACGAGGCAGAACCAGCGCTCCGG
CTTGGGGTATGGGAAATGCGGCGCGTACACCAAGTCGCACGTGTCGCCCTCCTTGACGTTCTTGCGCGTGAGCTGGATCGTCACCGTCATGATGTCGCCC
TCGGCGATCTCCTCCTCGTCGTCGACCGCGATCGTGATGTTAAGCTCAAGGTTCGGCATCATCTCGAGCACCTTGTTCACCTCCGCCTTCTGCTCTTCGG
TCAGATCGTTCAGGCCCTTGCGCTCCTTCGAGTCCATGTCGACGTACTGGTGCATGCTGCGCACGGCGTTCTTACCCGTGATGATGTGGCGCACCTCGTT
CTCCGTGAAGTGCGGCAGCTGCATGAATGGCGCGTCCTTGAAGAACAGCGCCTGCGTGAGGAACTGCTCCATCTCGATCAGGTTCAGCGTCGTTTGCAAC
CACGACTTGCCGACCGAAATCTCGAGCATGCCGTCGACGAGCTGAATCGCCTTCTTCAGCATCATGTGCAAGTCGCCCTTGAGCGTCGGGCTGAGCTTCT
CACGCATAAAATGCGCGTGGATGAGAATGTTCGCCTTGGCGATCGACGGGTGGTTGTACTTTGGCTTCGAGATGAGATCCTGCTGTTTGAACTTGCGGAA
GAGCGCGCCCAGCTCGGCCTCGTCCGACGCGCGCTTCGGGACCTCGCGGAATTCCGCCGAGCCCGCGAGCACCTCGGGAAGCATGCGCGGGTGCGCGTGC
TCCGACATGGCGAAGTTGTAGAAGCCGTACGTGTCGTACATGATCATGCTGTCACCGTACTTCTTTGAGTGCGAGTACCAGAGCGCGACGCACGACGGGA
TCGCGACGACGAGGATGATCAGGTACAGGAAGAGCACGATGTTGTGGTTCGCCGGGTCGAGGAGGAAGGTCGGGAGCCCAATCGAGAGCTGCATCGCCTG
GCGGCCGTCCGGGTTGCCAAATTTCTCGTAGTTGGCCTTTGCGACGTCGTCCGTGAGCGCCTCGTAGGCCTTGGCGACGAGCATGAACTTCTGGTCCGCG
ACCGCGTCGCCAATGTTCTTGTCCGGGTGGTAGATGAGACTCATCTTGCGGTAGGCGCGCTTGATGTCGCGCTCCGAGGCGCCCGTGGCGATGCCCAGGA
TCGCAAACGGGTCAAACGACTTGATCTCCGAGTCGTCCTTGAGCAGCACAGCCATCTGGAAGAGGCCGTACCAGAGCACGGCGAGCACGAGCAGGTTGGC
AACAAAGAGCGGCGAGAAGACGTTCGAGAGCTTGGTCTTCTCAGCCTGCAGCTGCTTCATCTTGCGCAACTCGCGGTCGCATCGGATGTTGGCGCGGTCG
ATCAGTCGGTCCTTGAGGAACACGCCGTAGACGATGCGGCGCAGTGACAGGTACGTCACGGGCACCACGTAGAGCACACCGAGCGAGATGGAGAAGTAGT
AGAACGCCGAGTTGTCGTACTCCAACATGGCGGCAGGCGGTTAGCGTAGCTCCTCAGCTTCTTCCGGCCTGTGCGATTTTGAAGACTGCACTCGTCTCGT
GGCCGAGGGGGCTGCTTGCCTGTGTGGAAACAGACACGTGGAGCCACGTGAAGAACGTTTTTATTTGTGAAATAGCCGTGGCTGAGGAAGTTTGTTGCAA
AAATAGACATGGTACTTAACCTTCGTTAACGCTCGTTAACCTCCAAGATCAGTCAATCACGTTGCTGAGTGTTTGATGGATTGCAAGTGATGAAGGTGGT
GTGCTGAGACGTAATTTTGAGGTGGCTGTGCGCATGTGCAGGGACAGTATCTGGATATGACGTTACGTGCTGGTGGCAGCAATCGGCCCTGTGATGATGG
CTGTGGTCGTGCAATGGTGGTGTTATGGTGTTGGTGTTGTGGTCAAAGGAACAGTACAGGCTCATTTATCGACCTCTGCTTTAGACCTGAGCCTCTTTGT
AATAGATGTAAGACGTATCTATATGTCCTTTACCTTCATATATTAGAAATTATACCATTTTTACTAAATGCAGCCGATATTAGAGGTGAACGGATCAAAA
GAAATGTTTAGATCGTACTTTACATGACACCATCAGTACATGTCCAGCATATAGATATAGAAACGAAAAGTGCTTGAACACAAATGTATTTCTAAACACC
CCGTTTCTATTTCTATTGTGGGTTGGTTGCCTTTTGACACCACTTTGGAAGGACGACGAGACGGACGGCCATGGGCAAGAAGAAGCGCGCGAATGACGGC
GACGAGGCCGGCGCTGCGAGCGCTTTCTCCTCCAGCGGCGGCGGCGGCAAGAAGCGCATCTTTTGCTACTACTGCGACCGCAACTTTGACGAGGAGAAGG
CGCTGATCCTGCACCAGAAGGCGCGCCACTTCAAGTGCCAAGTCTGCCACAAGAAGCTCTCGACGTCCGGCGGCATGGCGATCCACGCGCTGCAGGTGCA
CAAGGAGACGATCACGACGGTGCCGAACGGCAAACCCGGGCGCGACTCTATAGAAAACGATATCTATGGCATGCAGGGCGTTCCGGGGGAGGAGTCTGCA
CCATCAGCAGGTGAGTTTAATTCATGTCTGCGCTTTATATTGTATGTTGTTACGCTGTTGCTGACACTACACCCGGGTATTATCATGGCGTGTACTCGTA
GATACAAAAAAGCAGCGCGTTGATGCGCCACCAATGCAGAATGCGGGGATGATGGGCGCGTTCCCGGACCGAGGCATGCCGCAGGGCTTTCCTGCACGTC
CGCCGCCGCCACCTCTGCAGCATCTCCAGCCGCCTGGGATGGTTGGGATGCGACCGCCTCCGCTCGGAGGTATGCCTCCGAATATGGCATTCCGTCCACC
GCCACGACCCTTCCCAGGTGGACCGATGGTGCCGCCGCCACACATGGCGATGCCAGGTTTCCCTCCTCAGATCCCTGGCGCGCCACTCATGCAGCCACCG
TACGTATTGTGTATTTGCTACACTTGGCAGCGCACCATTTTCTAATACGTACGCTATTATTGGTGGTATAGGTTTGGTGCTCGTCCTCCATGGGCACCTC
CCGGGGCAATACCGCCGCCGGGCATGGTTCCAGGCTTTCCTCGTCCCTCAGGTGTGCCCCCTCCACACTTAATGCCTCCTTTCATGAATGCTCAGGCGCA
CATGTCGCCATCTTCTTCGTTGCCGGTAGCTGCCAATGGAGCTACTGTGAGCGCTATTGGCACGTACGCGCAGTCATTAGCAGCGCCCGAGTCGACAAAC
CCAGAAGACCCGACCGCGCAGCGCAAGCTCGCCGAGCTGGGACTGATTTATCAAGACGACCTCATCTCGATGGTACGCTCCAGCTCATTGTCTTGCTATC
CGCTGTGTATATGAGAGAATGCTGACGCACTGTTTAATTGTTGTGTGGATGTAGGAGGAGAAGCGTGCGTTGCGTCCCAACTATCGGTACAAGCCTGCGA
ATGCCGTCATGAGCGAGAGCGGATGATAGGAGGGAACCAAAGATGAGACCCCCAGGTTGGCAGCATATTTGATCAAGTACACTCGCTTCTATTGCTACGC
ATATATGAATGCGCCTCCTGCTTCTATAGATTACATGAGTTTTTCTTTCTTTCTTGTGTTTGTGTACAGACTGCCGACAACCCGTGCTCTCAACCTTCCG
GATACCCGCCATACTTGGAGCAGTATCTCTTGAAGGATTCGGCCGCTGGGGATGGAGACGGATCTACTGGGATGCTGTTGCTGCTGCTGTTGTTCGAGTC
GTTTCCTGTACGTGCTGTTTCTGAGCTCCCGATATCGAACTGGGCCTGGCTCCAGTTCGCTGAGTTGTTGGTGTTACTCTCCAAGTGCTTCCGTGGACTT
TGGTAGACGGAGCTCAGAACGGACGGGGTCGCTGACGCTTGGAACGCAGCGAGATTGAAGGATCGACGGGGGCCGCTGTAGCCATTCTCTTCGCGTCCAC
GGCTTCGCCCGAGAGAGCTGCTGTCATTGCTTTTTCTGGAGAGCAAGTTCGTCGCCGAGTCGTCGCGCTGTTCTACCACTGAGCCTCTGGTGGCTGAGTT
CGTCGGACTCGTGATCTCGGTGCCCAGTCTGATGTGTACCGCAGCTGCCTTGGGGGAATCGTAGATCCGCAAGAACACATTCGTCGGCGATGAGATGGTG
TCCATGTTCGTATAACGCTCCTGGATCGCGGGCGACCCCGGGTACCTTGTCAAGTCGTCGTTGTCTGTGTGGTGGCTCTTGAGAAATGATCGCCTCATGA
GTCGGATCCGCGTCTTCGCGATTTCGTACGTCACTTTCTGCCCAGCTCGACTCGGTTCGCTATTCAAGTCGACGAAGATGCCAGTCAAGCTCATGACGAG
AACAAGGCTCGGCATCGTCATCGGCGTGATGATACACAGCGAAATGAACGGCAGGAGCACCATCAGCGGCAGTAGGAAGACGGCTTCGTCTTTCTCCACG
ATGGTGGGTGCTGCAACGAGAGAGAGCCACACGAGGTAGAAAGCCTGACTGATCGTTGCGAACTGAAACATCCGGAGTAGCAGCTTCGGACTATCAAACC
AAAAGCGGTCGTCGTGGTAGTGAAGCTGGCGATGACAGAGTGCCGACATCTGCATGCGAATCATCGCTCGTACGCCCAGCGCGACGGTTTTGAGCGTCAG
GCGCTTTGGCGGCATGGTGATGAAGCTTTCAACCGCCTGCTGTTGCTGCTCTGCGGGCGTGAGAGCGCCATCGTAACTGTCTTCATTGGCACTTTGGATG
TTCGCAAGCCGGACTTTGATGTCGCGCATGGTGATCACGCGCAGCCGGTCGTCGACGATTCCGCGCAGAATCTTGAGCACTTTAAAAAAGATGATGAGGT
TTGCGAGGAGCAGCACGCCACCCACGCCAATGAAGATCCAGTGATCGTACGCTGGGTACAGCGACGGGAGAACGGAGATGACGACGAGGATGAAGAGCGC
GCTAAAGTGCAGATCCGTGATGTGGTACAGCAAGTTGCGCATGCAGAGCACGTGGTAGCGCACGTACGTCATGGGCATTTGATCTGGCTCAGGACGTAGC
AGGTTCTGCGAGCGTGGCGGCGGCTTCACGCCAAACAGTCGCTCCATCTCGTCCGGGTTCTTGTAAATGTACCCCGACCGGTTCTGACAAATGTTGTACG
CCAGGATCTCAAAACTCTTCCAAAGATGCCACTGCTTGTGCAGATTAAACCGGAAACACCAGCCTTCACGCTCGTACCGTTCAAGCAGCAAACTGTACGC
GCGCGAGCCCTGCACGAGGTCCATCCCGGATTTCACGCGCCGTAGCGTGGACGCTCGAGCTGGGTGGCGACGCGACCCCGAGATCAGATCGCCGCGCGCG
AAGCGATCTTCGGACCCGTCGAGTGTCCGGTCAGCGTAGAGCCCGTCACCATCGTCGTCATCGTCGTCGTGGACTCCAAACGCCGCAGCGAGGCTCTCTT
CGTACTCGTCCTCGATTTCCTCTGCGTCCTGCGCCTTCCAGATGAGTTTGGGCACGACCGTGCCGATAAAGAGCAGCAGCAGCACGATCACGATGAAGTA
GATCATCGTGAGGAAGACTATGTAGTGGAAGAACTCGTAGAAGTGGAGCTGCTCCGTTGGCGTGAGCGCGTCGACGGCGAAGTTCATCTTCTTCATCACG
CCGCTCGTGTTGAGCGTGAAGATGACCATGGAGATGAAGCCCATGATCATGACTTCCTGGAAGATGCGGTCGACGATCTTGCTCAGCTGCGGGCAGTGGA
TGCTGTGGCGCGCAAAGTGGATGAGCCGGTCGAAGAAGATCGAGACGACGACGATGACCCCGAGCAGGAACACGGCCGTGCCGATGTTCTCGTGTAGGCA
GTGCGTGTTACCTACGCCGAGGAACGACGTCGCGTCGTGGCAGCGCCCGTTCGACGCGCCGCCGTCTGCGCTTTCGTTCGCATCACCCGCTAGCTTCCGC