Description :
From Genome Similarity Track
Location :
contig_62:22204- 24098
Transcript NameFunction/comments
g9223.t1hypothetical protein
g9224.t1ATP-binding Cassette (ABC) Superfamily

Sequence
1894 bases(100 bases per row)
TCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGAC
CAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCAC
TCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCA
TCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGC
GACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGCCTATCAAATGCCCCAGCGACTTTCAATCGCT
TGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCGA
GGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAA
GTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTTC
GCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTG
GCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCGGTCCTGGCTTTGCCGGACGAGACAAAACCGTTCAGC
GTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTA
AAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTT
TGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAAC
TTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCCGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAG
ATCTGTACGATCGGATACGCTAGCGTATCGAGATGATGAGAATCTCTCCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGCCAAGCATGCATGGCTAA
CGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGATCCGGCCGATCCTCCGCGGATAGTCGTCCCCAA
CGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAGGTC
TTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGCCAGCGAGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGC
AGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT