Description :
From Genome Similarity Track
Location :
scaffold_209:22202- 25826
Transcript NameFunction/comments
Pl_107672DEAD/DEAH box RNA helicase, putative
Pl_107673hypothetical protein PHYSODRAFT_284180
Pl_107674hypothetical protein PHYSODRAFT_554353

Sequence
3624 bases(100 bases per row)
TGCTCGTGAATACCAATTCGTTGTAGACCACCCACTTGGGTGGCGGGTTGCGCATGAACAACGATGACGAAGGGTGAACCTTGACAATCTCTGACCGACC
ACACATGGTCTTGTACGCAGTCTTGGATCCACCCAGACCCTCAGCGACAGACCTCATGGCTGTATTCAGGAAGAAACCAGCCACAATGCTCTTCCGCAAC
GGATCGATATCCGGGAAGCTCGAGTCGATGGGCAGCTCCAGTTTTTCCAAGTACCCCTTGAGCTGCAACCGTACACTCTCGACGCGCGTCATGGCGCGGT
GGTTGATGTAGTGGTCGCGACACCACTTGTTGCGCTGCTTCGCACCACACTGCACGTAGCCGTTGAAAACATTCAACAGCGTGATCTGGTCTCCTTCGTA
CGCGACGAACCGTGCACGTGACTGAGCAGCCTCAGCCTTCTTGTCACGAGGAGAGTAGAAGATGGACTCGACAGACAACATCGCTACAACTCTCAGCGCT
TCTTCAGCACAGCACAGCTCTGCCGCCTTCAGCAACATTACAGCGTACATGGGCTCGACAGGGAGACCAGCCATCTGTCGACCACGAGTCGTCAGCTTCC
CCTTGTTGTCGAGCGCTCCCAGAGCGTATAGCTTCTCAAGAGCCTTGATCAGGGACGTCTTGAGCGGCTTTTCAATGAAATCAAAACCCAACACATCGTC
GATGCCCATGCATTTGAGCTGCAGCACCACGACCTCCAAACTCACTCGTTGGATATCCGGAATCGCGCGCTCCGGAAGCTGCTCGAAAGTCTCCTCAGGG
AACAACCGGTAGCAAATACCAGGAGCCTCACGACCAGCACGACCTGTGCGTTGCCAAGCTTGCGCTTTCGACACCGACTCTGTCTGCAGCATTTCCATAC
CACTGGAGGCAACAAACGAGCGCTGCTTGACGAGACCCGTGTCTACAACATATCGGACTCCGTTGATGGTAATAGAAGTCTCTGCAATATTCGTAGCGAG
AATCACCTTGCGAACTCCTGGTGGTGCGGGTTCAAACACCTTCATCTGCTGTTCACGCGGCATGGCAGCAAAAATTGGGCATACCATGAGCTTCAATGCA
TCAGCAGGTAGCGATCGTGCATACTCTTCCAGCAACGTCTCCAATGTTTCAATATCTTCTTGACCTGTCAAGAACACCAAAATACTGCCATTATTCGTCT
TCTCATCCAAGTGAATCTGCAACACCGCCACCAACGCCGAGTCGAGATAATCAGGCTGCGTCTTCGCTGTATAAAACACATCCACTTGGAACATACGTCC
AGGAATCTGAATCACCGACGGCTTAAAGTCCTCAAAGAACCTCCTAAACAGCGCCACATCCAGCGTAGCTGACATAACCACCACTTTGAGGTCTTTACGT
TTTCGCATGGCGCGCTTCACAATACCGAACAGAATGTCCGTCTGCAGTGTACGTTCATGTGCTTCATCCAACACGACAACCGAGTATCTCTCGAGCGTGG
GAGACAGCAGCGCCTCACGCACCAGCATACCATCCGTCATAAACTTGAGTCTTGTGTTCTTGGATGTCGTATCGTCGAAACGGACGCAGTAGCCGACAGC
GTCGCCTAATGACCCACGGTTGGCCTCCTCACACACGCGCTGGGCCACAGTGATGGCAGCGACGCGACGTGGCTGCGTGATGGCTACACGAGCATGTGCA
CGGTCACTCTCCCAAATGTATTGCGGGATCTGCGTCGTCTTGCCACTGCCTGTTTCACCCACGAGGATCACCACTTGGTTGCCATTGACAGCCTCGATGA
TTTTACTGCGATGCGCGTAAATGGGCAGACGCTGGCGAGTGCGTTGCAGCTCTGATGCGACTGGATTGGCGGCATTGACGCGGTGCTGATGCTTCTTGTG
GTGCTTGAAGCCAGAACCTGATGATTGCATCGGACGCTTGCGCTGGGCGCCATGACCATGGCTAGGAAGCGTCATGGGCAATTGGTTGGTTAGTGGCGAT
ACTGAGACCAAGTGAATGAAATGTGAAAAGAAGAAATGTGATTGGCTGAAATTAGGTTCCAGTGACGTTGTGTGTAGCAAGTACCGTATTCCTATCAAAA
ATGATCTGCAAACGTGTTGAGCTAGCATCGCAGTTGGATTGATTTTTTAAGGTGACTGATGCGTTTACATTCGGCCTTTGCGGCCCATGGTGTGCATGCG
CTGCTTGGATGGCGCTCTGCACACAAACACCATAACTATCAGTAAGAAGAATTCAGCACGTATGAGCTCGCGGTACTTACACTCCTCGTCTTGATCCAGC
CTCAACGAACGGATTGAACTCTTCGCCTTGACGGTAGGTTCCACCACCAGATGCAAAACCCTTGCCTCGCTCATTTGCACGAGCAGCCATCTTGGTCCGA
ATACTTTCGTCCCGGGTCCGCTCCTCCTCCTCTTGCTTTTCCGCCAAACTGTCATCAGTCAGTGACAGAAACGTTAGAACAGTATCCACAACAAACAGAT
TTTAATCAGGCTGTACGTGAGAATGGTGTTGATCTTCTCGCATATCTCAGCAGACTGCGTTTTCCAGTTGATAAGCTTCTGAATCATATCGTCGATGTCC
TCGTGATGCGTGTCACGTCCAACCGCATACTTTACAACGAAGCAGCGCGATTTCTGGTCCAACTTGCCTTGAATTAGTCCCTGCAACCGGCAGTAATCCA
ACGCACCAGTAAATACAAGAACCACACTCCTTTTCAAATGGCAGAATATCTTTCGTACAGAATAAATGGTGTCGATGAGGATATCTTCCACCTCGCGCAC
CGTTGACACACCCAAGTCTTGCATCAGCGTATCGTACGGGATGTTCTACGCACCGCAGGTAGTCGTATTAGTCCAAATATCAATTATCCATTCACGAAAG
CACCAAATACTCCTCCACCTTAAATCTGTGCGCGAGCGACACCGTTGTGAGTTTTCTGAGTTTGTTCACCTGTTGCGGTGTGAGCTCAGGCAATTCTTCC
TTTCGTGCTACAACAATAATAGATCCAGTTAGAACAATTGAACTCTTTACCACATAAACTACAAATTCGATGCCACCCACCCACATAATCGTTGTACGTT
CCGAAGCAGAAGATGCGCAGCATCTCGTAGTGTTCCTTGTACTCCGAGTCTTTGAGCGCCTCCACATTGGGCATGTCCAGCAGCTCGCGGAATACAAACA
GCTTCTTGTTACTCAGAACCTGTTGTATCAGTGCCACGCACGCGCGACCACGAGCATTCTTGGCCAGCAGCGTGAACTGCTCGAGACTCGCTGCCCCCGC
CGCGTCGAATGCCATCGTCAACTCCTTCTCGGATACAAAAGTGGCAAATCTATCAAAAAAGTGTAAGGTACATTAATTATTGTGACACACACAAATTAGT
ACGAACCATTCTAAATAATTGTTGGCGTGCTTTTTATTGAAGAAATGAACGAGGACTTGGAGGCCAACATCCAGCAGGCGCTGCCGAGCGCACTCAAGAT
GGCGCTGTATGCGGCCAAGAAGCAGCAATTAGAGCTGCTTAAGTACACGATCGAGGGCGTGGATTCACTGTGTAATAACGCAGCGTTCCTGAAGGACCTG
GAGGACCAGGAGCACTTGCAGCAG