Description :
From Genome Similarity Track
Location :
Scaffold_48:222015- 223378
Transcript NameFunction/comments
Aphas_H257_13401PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1363 bases(100 bases per row)
AAGCTGGATGTTGCCAAATTCGGCGAAGCGGAGTCGGACAAACTCCTCCGCTGGCTTTTACAAGTCAGCACTGCTGCTGATGCTCAGCGTATCTCCGACG
ACGCCACCCACGTAGCTTTCGCGATGTCGCATTTGAAGGGTTGTGCGGAAGATTGGGCGTTCTCCAAACGCTTGACGGACCGCCACTGCTTCCAATCTTT
CGTGGTCTTTGAGACCGAACTCAAGGCAATGTTCCTGCCACCCAACAGCGACTTTCGTTATCGATCGAAATATCTGGCTTGCAAGATAGGGTAACGCTCC
CTTCAAGAGTTCATCCATGATCTTCGCTTCTTGGCTGCGAACATTAACGATGAAGAGTCACTCCCGGAGCCCCTGCGGGTGACCGTTTTCATGGACGGTC
TCAACCAAGGCCCGGCGCGCACATAGCTGTTTCGTGCCTACCCGGACACCTTTGAAGAAGCCGTCCGAATCGCGCTTTCGGAATCGTTTTTCTCCTCCTT
CGCGCACGCACACGCGGCGTCCTCCGACATGGATGTCTCCATGCTCGCCCAGGCATCGGACGACCGCACGTGTTTCAATTGCGGTCGCCCGGGACACTTC
TCCCGCGCATGCCAGGCCCCTCGCCGTGTGGCGTCAGCCGCCCCGCCCTTACACGTTTCCTCCCGTACTGCGCCCGATACCCCTTCGCGACGCCCTCCGA
GCGGTCCACCACCGAACCGCATCAATCCTGAACGCCATGGTGGCTCACGTCCACCATTCCACCCCGCTCCGAGCTCGAGTGCGGCGGGAAACGGCGCGAG
GTGACCTACTGGGGACACCCTAGGTCCTTTGGAGGTGTGTGGCGTGCTGACACACTCTAAGGACCTAGCCTCAGACATGGATCTTCTGTGTCGTGTTGGG
CTCCAACCAAGAAAATGATTTGTTTGGAACTTGTCGTGCCTGGCTTCCCGGCCAGGCTCTCTGCTTTAATCGATTGTGGGGCGTCGAACAACTACGCCAG
ACGCGCCACTCTCTCTCGCTTCAACCTCTTCGGATCCCTCCGACAGGGTTCGCGTCAAGATGGCCAACGGCCACACTGAGTCTCAACCACGCATAATCGT
CGATGTTCCCATCACCTTCGACGGTTTCGACTCAGTCGAACCGTTCTATGTTATCGACCTCGATGAGAGATGGGATCTCATCATCGGGATATCCTGGCTG
GAGTCCCACCAGCCATGGATTGACTGGAAGGCCAAATTCGTGTACAAGGTTTCTTGGCTCAACGCGAGACAACCCTGGATTCATCGGCGGGCTGCCGATC
GCCTTCCCCCGTCTACCACCAACCCGCTTGGCCCTCCGCTAGAGGCGATGAGTAATGATCTCG