Description :
From Genome Similarity Track
Location :
Scaffold_712:2220- 3615
Sequence
1395 bases(100 bases per row)
AAGTTGTACGAGCTGATCAAGAAGCTGCTAGAAGGAGGAGTGATCGAATACTGCGACTCtGAGTGGGCCAGTCCGATCGCGTGGTGATGAagAAGAATGG
CGTCGACATCCGGTTGTGTATTGAATACCGCCGAGTGAATCGGCTTATCAAGCTACTGAACTACCCGCTTCCTATCATCGACGACCTACTGACCGGTTTC
GACAAAGCGATGTGGTTTCTCAGTCTCGACATGGCGAGCGGGTTCTGGGCTGTTAAGCGGACCCGTAGAGCCAAACACCTCAGTGCGTTTGTGTGCCCAC
TGGGTCATTTCCAGTGGGTTCGAATGCCCTTTGGACTCAAGAACGCACCTCTCGTTTACCAAATGGTCATCGACAACTGCCTGTGGGGCTATGTGCGACT
ACCACCGGCTCTTGAAGCTGAAGTCGAACCGGATGTGCTGACCGGACTTGGTCTGGACGCGGTTAAGAGCGATGATCCGGTACAATCTAAGATGGATCAA
GTCGAGAAAACAGTTTTTGAGCTGTGTCTGCCAGCACCGAAGTGTTTTGGGCCGGTTCTTGGCCGCAGCTCGTACATTGACGATGTTGCGTTTGGTGCCG
AGAACTGGGGTGGGCTCCATGACGTACTTGACAAGTTACTGTATCGACTCCGGTACTGGCGGCTATCGGTTGGTTTGCCGAAGAGCATGTTCGGGAAGCG
GGCAATCGACTACCTGTCACACGAGATCAGCCGGtCGGGTTTGCGAGCGACACCGAAGATCGCCAAAGAACTGGATGGCTTCCTCCAACCAGCCTTAAGG
GTGTGCAGTCGTTCCTCGGTAGTGTTAACTACCACAGCAAGTTCATTGAGGATTATGCCGTGATTGGAAGTGCGCTGTACGAACTCACCGACGAGCAGAT
CCGGTCTGGCCGAGACTTGGACGCCGCGAAGAGGTCATTCGAGTTGTTGAAGGAGAAGATTGCGTCGCCGCCAGTGCTCAAGCACCCGGACCCTTCACGC
CCCTTCATCATCATTCCTCACGCGAATCGCTGGGCGGTCAGCTCAGTTTTCGGtCAGGAGTACGATGGAGTCATTCACCCGGTCCGCTTCACCCGCCGAA
CGCTCCAGGACGTCGAGCTGAATTACCACGAGACCGAGAAGGAAGTGCTGGCAATACTTCGTACACTGAACGTGTATTACACAATGTTAGCCGGCAGCAA
GCTACTTGTATATACAAGGTACTCAACGCTCAAGTGGATTATGACCTCGAGGTCACTCCAAAGCCGGTTGCTACAGTGGGCAGCTCTTCTATCACCGTGG
ACGTTTGAAGTTCACCGGGTCAATCGAGATGAAGACGGACTCGCCGCACTGCTCGCTGCCAGTATCACGCCCAGGGAGAGACTGGACGAGATCGC