Description :
From Genome Similarity Track
Location :
Scaffold_1425:2220- 3585
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1425-fgenesh-gene-0.1C2 domain-containing protein

Sequence
1365 bases(100 bases per row)
TACTTCCACGCGTCCAGAATCTCTTGCCGAGTCTTCATGAGCTCGGGATCGTCGCGGTCGAGCGCCTCGACCGAGATGCCGGGGAAGTTGTTTTCGAAGA
GCGCCTTGAGTTGCGGCAGCTGCTCCTTAGGCGGAGCGTACGTGCCGCTGTTGTTGTCGATCACGAGCTTGGTCTGTCCGAAGAGCGCCATTTCAATGTA
GAACTCGCCAGCGTACCTATTCCACAAGCTCACATTCAGCGACCACGTCTCGACCAACCAGCCACACACATTTTCAAAACAGGATGCACTCACAAGACGG
AGAAGTTGGCGCCAGAGTGCAGCATGTGCTTGGAGAGCATGTCCTTGAAGAAGGCGGCACCTGTCTCGGAGAAGTACCAGCCCTTCTTGGTGATAACGTA
CGTGAAGATGACGGGCTTGTCCTGCCGCCGTCCGTCGTGGACGAGCCGGAAGAAGTCGGCGGCCGACGCCATCGAGCCGTACACGGTGGTCGGGATGTGC
TTGTAAGCCATGACGTGCTGCATCATGACGGCCCTGCGCAGCACGGGCGACTCTGGGTAGTCTGGAGAGAAGATCCGCTGGATCGCCGGGTAGTCCTTGT
TCCACTCGTTCTCAGTCTGAAGAAACAGCGGCACGTTGTGCAGCTGGACGCGGTACGCCACGGACTCGAGCTTGGCGTCGTTCGACAAGGACAGCGTCAG
CAACCCCGTCGCGACGCTCGAGTGAGCCGAGTATTGCACTGGGCCGTACTGCTCCGGCACCGGGTATTGGCTCGGGTAGATTGGATGCGACTTGATCTGT
CCGTATCAGCTTTGGTGAGTTTGTGTAGTAGGAGTAAACTAAACAGGCCGCACTGACCTTGACGAGGATCTTGCCGGCGCTTGACCCGAGGTGGGTGATC
ACGAGCTCGAACGCGGCCTCGCGTCCGTCGGTGTTGAAAGCCCGGAACTGCGCCTCACCGAGCGGGTCGTCGGCGTCCACGTCCTTGTCGAACAGGAACA
GCTTGCACATTGCGTCTTGCTGGACGTTCCGGAAGTAGAACGCCTCGTTCCACACAGGCTCGAGCGTGTTGAAGATGGGGCGGGTCCTGTTTGGAATGCA
AGCGTTGGGTGAGGCTTGACCTAGCGGACACGGTCGCTGAGGCGGAACGTACCAGGCCACCTTGTTGCCTTCGATGTCGACCACAACGTAGGCATCGCTC
GAGGACCACTGACCCCTGAGCGCGGCCGTCAGACCAAAGAAGTCGCCGGCAGTGATGCCCTGCGATTGACATTGCAGATGTTAGGGGACTACAGAACCGC
CAGACAGCTCAGACAAACACCGACCTTGGCGGACACGATCTGCAGCTCGAGGTCGAGCACGGACA