Description :
From Genome Similarity Track
Location :
Scaffold_1535:222- 4379
Sequence
4157 bases(100 bases per row)
CTTCCTCCTAATACACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTACGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACC
AGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCC
AACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACGCGGTCGGATACATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGGACCAACT
TCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGATTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGG
TCCATGTCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCA
TCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCC
ATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGT
ATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATCCATCTTG
AGTGCTCTCGTGATCGTCTGCACCATACGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGA
ATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCTCCAAATCGTCGGAAAACGCACTCCTCGTACGATTCAGC
AATGGTTTGCGCAGTTCTAGACGCACTGGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAAATCAACAACTCTGTGTTTCCTTTGAACGACTTG
GGCAACGAGGGGATATGATCCATGGCTATGTTTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTG
TCTCACAATCCACGCATTCACCGACATATCGCTGTACGCTCTTGAATAGTCCTCTCCAGTGATAACATTTCCGGATCCGTTGGTAGGCCCGACCAATACC
CTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTG
ACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAAGATTTAGTATCCTCCCGACTCAGGT
CTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGGCTCCCTTCACAAATAT
TTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCG
TCTAGTCGGTTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCAC
TGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCTGGGGCCTT
GCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGA
AGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGGTCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCAC
TGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCAAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCG
GCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGTATCTCGTCTTCC
CCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTA
ACGTAGAGTGCCGGGTCAGGATCCGGATCTTCCCATCAGCAGGTTGTAATTCAGATCCAATACGCGCAGGAGCGCGAGTATCTCTTTCTCCATCGCTCCG
TAGTTCAGTTCATACGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCCTGTACCAGAGCTGCTGAGACGGCCCAGTCAC
TGGCATAAACTATAACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCTTGTTCCTCAGTTCCATGAATGCGTGTTGAGC
TCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCGGT
TTTAGGTCCTCTTCTGACGCCGTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGG
TCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGTAGTAGTTCAAACTGCCCTAGAA
GGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGACTAATGAAGACAGATCCTTAGGATTCGCCTCCAATCCCTCCTTGGACACCCGATGGCCT
AAGTTATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTTCAGTAGGGATGTCACTCTCTCGCACA
ACTAATCCCACGATTCCGCTGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCTCCTGGCTCCCCCGCTTCGAA
TGGATCCACTTCCGTATGGCCTTCCCCGGACCCACCCGTTTCGGGCTCCGGTATCCGGGTAAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATC
TGAGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACTGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAA
CCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAA
TCGAGTCAGACCGTTAGCCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGAATACCACTGGGGATGCCCACGGGGACGTC
GAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGAAACTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGTT
TCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTG
ACGCAGAAGATCCACTTCAGCAGGTTCATTCGCTTCCGGATCCACTTGGATATCATC