Description :
From Genome Similarity Track
Location :
Scaffold_1841:222- 4274
Transcript NameFunction/comments
Phyag_g11591hypothetical protein PHYSODRAFT_350798
Phyag_g11592hypothetical protein PHYSODRAFT_385567

Sequence
4052 bases(100 bases per row)
CGCGATCAGATTCATTCTCCTCTGTGAATTCGCCACCAACCTCCGACCCGGAGTCCAAGATGCCGCAACGACCCGAGAGAAACCCCCCGTGGGCGACGCT
TCAAGTACACGCCGGACGCACCAACTGCATCCGCGCCAAGCTCTACAACGCTGTGGGGTGACGTCGCCCGTCAAGTCCACGATCTTCGACTGTACTCCCT
CGACGGACATATCCTGCGCATATGTGCCCGCACACTCGTGCTCAGCCTCCGGCGAAAAAAACCACGCTCGCGTCGCCGCGAGCAAACTGGGACGACGCAT
TAGTACCGATCCCGCGGCTTTCGCTAGCCAGAAGGACAATTGGGTTCGTCATGAGGTTGAAGCACTAATACTGCACTGAGTACGGCAAGATCGTGGTGta
cgacgaaagcgacacTGCACGGCTACGAGAGCCCCAAACAACCAATGTGTACGGCGACCGAGCTCACGATGTTCAAGGACGGACTGAGCGATACACGTCA
TTATATACAACAAGATCGAGGTCTCCACCTGGGGGACTGTGAGTGGCTTCTCAAGTTGCGGTCGCAACGGGGAGCTGCGTTCAGCTTAGTGTTGTGAGCA
GGACTTTCATTGCGGCTGCACCGATCGGACGAACAGTTCGCCAACAAATTCGGCGTGCTGGTAACGAGGTAGCATCGAGTAAGAGTAGTTAGTCCCGATG
CTGGGTATTCCCAGTGTAAGCGCAGTAATCTAGTTGTGGATTTGTCAACGCTGTTCGCAATATTTACCTCATGAAGAACGGTGAAGCCTACCCGTGGCGC
CCAACGGGCCCAACAAAATAGCTGACTGTAGCTAGAGCGGTCGAACGAGTGAGGTAGTGGTGGAGGTCTAACTAGAATCGGTAGTGAGGTGCTCCACGTA
CTTCCAGTCCCACTCCTCTCGGTGCAGCTCGATCGTAGGCCAGTAGTGGTAGTCTGTCTTGAGTGTGAACACCTTTGGCTTGGTGTTGATGGAAATGGTC
TTCAGACGCACTGATTCGCGATTTCCCAGGCGTTCCACCACCCGCAAGAAGTCGTCTAATGTGCGGGTAGGCTCGCCGTTGACTTCCACGAGCCAAATAG
TTGCCCGCAGGCCGTACTTGTGAGCTGGAGATCCATAGCACCATCTCGAACAATACACGCCGCCACCTTCCTCGGGAATGTAGCCCAAGTTCGCAACTGC
GTAATGGGGACTTTGGATGACAAGACCGCACCAGACAATGACACGATCGGTGCCCATAGCAGAAAGCTGGCACGTGTTGACAGtcacctccatctccttc
tggTCGCGCACAACCAACGCCGACACTTCGGTTTTACCGTCTACTGCGCCTTCCACATCTGCGTCGCGCACAACAACGTGACCGTCAACTGCTAGAAGCA
GGTCACCACTCTCCAGTTTCTCGGCGCAGTtcgtgccagcagcacaacgtTTAACTCCAAGAACCTGGCGCTTGTCCTCGTAACATGACTCCAGTTTCTG
AATCCATGCATCCGATAACCCAAGACCGGAGCGCGCTTTCGACAGTGAATACGTCAGCAATTGCACAGGCAGGATGTTAACTGATGCAGGGATTCGAGAC
GTCCGAAGCTCGTCAATAATGGGTTGCACGATGCTGACTGGGAGGCCACGGAAAACTTCCTTGCGACCAGCGTTGTCCTGGTAACTAAAAGAAAGCCAAA
GTGCATTAACAGCACCTGCGTCATTAATGAAGACGCCACCCACAGACTTTGTGATCCGATCAAAATGCAACACCTCAATGTTGCATGCTTTGTAGCGCGG
AGGCTGGAAATCACGCAGCACGAGGCGATCCAGTTTGGTGACCACGGACTTCATCGTGACCACAGTCCAGTTACTGCTCAGTCCGATGTAGTCAGCGGTC
TCGCCAACTTCTAGCGGCTTATCAGCCAACACCACACTCTCGAGGTGGCTGGCAACAGCGCCCAGCGCCTTCGGGTCGTATTTTACAATAGAGAAGTTGT
GTACAGGGTGCACGAAAACCACTTTGGCGGGGATTTCTACAGTAGCAGCGATTGTAATCAACACGTCGCCCAAAGCGATAGGAACCGTGTTCTGGTCGAC
GAGCACAAAACCCTGCTCAGCAtccaccacgacgcccatTCCGTGGTAGCTCGAGCTCGATATACCGTCAATCATGTAAGGAATATCAAACGACACCATA
ACCAGAGATaacagcgtcttcttgcccagtGCATTACCTCCAGGAAAACTCAATGGCGCTGGAGCAAATGTCGGATTTCCGTTTGCTGCCTTCACAGCCG
AGTTGTCGCCGTTTACTGCACCCTGGACGTACGCCTTAGAATACCACAatccgtcttcatcgttgcGGGTACACATCTGCATCGGGAACCACAGGCGATC
CATCATAATGAACGCTGTGCGAACACGGTGGCGATCTCGAATCATAAAATACCGCAATACCGTGCGAAAGCCGTTCGGAAGCGAGGCCATAACGCGCGCA
AAGTCGTCTAACGTTGGGGTCGACTGTCCCGCCACGGACGTGATGATACAGGGCTGGGCCAGATGCGCCTTCATGAACATGTGTCCAGCCTGCGCTAGAT
ACACGCCACCAACCGGCAGGGACGCATTGCGCGCTTGCTGGTACGATAACGCATGCACAATTCCGCCTCCGATCTCCAAATATCTATCCGGCGTGATGGC
ATGCAAATCCTGGACATCCAACGTAACAGTGTACTGCTCGTCTCCGCGCTGGAACTGCGCCTCCACATTTTCCCCAACATGTGCGTCCAAAAACTCCTCA
ATCGTCAAAAACGTCGCTCCATACTGCTCTGCAAATTTAATCAGCACGTCTCCTGTTTTCAATTTATCATGAGCTGGTCCTCCTTGAATCACCTGATCCA
CCACGAGCATCCCCGTCTCCTGCGGGAATTGCTGCCTCACCAACGCCTCCGTCTCCCCCGGAAGTCCCAACCTCCTCACCTCATCAAAAGCCGTATGACG
GAAAATGGTCTGAATCGTCCCGCGCGGCACTGCTTGTCCCTGCTGAATAAGCCCCAGAACTCTCACCACTCGATCCAACGGCAAGTAAAAAGACGACGCC
GCCTTTTtcgctcctccagcattgAGTGCAATAGCACATCCGTCAATATTCAGCACAGGAGAGCCACTGGATCCCCCACTGGTGCTActagctgctgcaa
agtaGAACGTATTGAAGTCATTGTATGTACTGGATCCATACGACGGCGCGTCACGGTCCAATTTGGCCAGAATCCCTGGCAAAATCGACAATTTCTCGCC
TGCGTCATTCCCGACAACGCGGATTTCAGCTCCGATTTTTGCAGCTTCCGGTTTCAGTGGAATTTCATGCAATTGCAAGAATTTCACCTTTTTAGGGTCA
AATTTGAAGAACCCGAAGTCGTGCACGGGGTCCCGATAGATGGGCACGAgatccacttcttctttATTGAGGAAGAtggcgtcggccaccacGGGCCCAG
GGGTGACCACGTGGCGGTTCGTCAGGATCAGACCGCGCTCCATGTCCACCACGAATCCCGTGGCCACGCTGAAGCTGGCGCCGTTGCCGTCGAACGCGCG
TACACTGAGCAGGCGGATGCTCACGATGGCTCGGATGCACTTCTCCAGACTCTGCAGCCACCGCTTCGACTCGCCGGTGGCCGCTGCGTCCACGCCGAAG
CCGTTGAACTGCAGGGCGGCggacgaggcggcggtgACGGGCGTCGGTATGGGCTTGAGCATCGGCTCGTCGTGGTCCTCCATCGTGGATTGCTACAGAG
TGGCAAAGCGACCTGACGACTGGAGACTCGTTTTGTGAATGAGAGATATTGACGAAAAACTGAAGCAAAAGAGTGTGTGGTGGACATGAAATTGGAATTG
ACAGATGGCTACCTTTTTAGGGAGCCATAGTTTGTTTTtcggtcacttcaacatgcacgCAACCTGATcccttccttccttccttcctcaCTTTGTCGTT
GCGCTTGCTTACGAGAACTGTGGGAGCgtggtttcttcttcctgtcgctTGG