Description :
From Genome Similarity Track
Location :
Scaffold_455:222- 4012
Sequence
3790 bases(100 bases per row)
CTGCATAGCCTGGAAACGGGCCCGCGCTCTTGCGCCTTGATTGAATTCGTAGAGCAGGGCACCACAGTTGAGCTTCGACACAGGCAGCCACTCGGTCTCA
TCATACCCCTTCCACTTCACAAGGTACTCACGAATTCGTCTCGCTGTCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCGCTCAACTTCGTACTGAT
TGTTCGCAGCGTCGGGCTCCCAACTGTCTTCAGGCAACAGCGCCGCATCAAAGTCATCATCCTCGTCCACGTCGATCTCCACAGTGGGCCGCTTCGGGAA
TAGTGCTCTGGGTTTCAAACGGCTCACGTGTACCCAGGGATTCACGCGATATCCTGTATTCTCGACCCTGAGTTTCACGCGGAAGTTGTCATAGATTTCC
TGAATTCTGAAGGGGCCATGCCACATGTGAGCCAGTTTGCGGCTCAGCCCGGGCTGCACTGTGGGTATATACAGCCACGCAGCATCACCGGCTGCGAATC
CTCCCTTCAGTCGTTCGGACAGCTCTCTCCACTTCCTGGTTTGTTCGGCAGAGCGCGCGCGCTTGGCCTTCCTCTGAAGATCCTCAGCGCAAGCTTGTGC
ATAACTATAGTCACGCTGTAGCTTCCTGCGCCACTCGTACGCAGTGCGCTCCTGGATACTCGAGGGCCTGGGTCCTACATTGCAGACACCGTGTCGTGTG
CGTCCCAGCTGTGCACCGAAAAAAACGGAGTGTCCCAGCAAGTGGCATCAAACGATGGTATCACGGCAAACATCAGGCGCTCAGCATGGTCGTCTCAGTC
ACCTCTGGCCGCCTTCACAATGTACGCTCGAATGCTGCGCACGACAGTCTGCACCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGCCAGAGTG
GCTCGCTGCTTGCTACCCAAAAGTTCACGGAAACGCGTGAACACCTCACTCATGAACCTTGGGTCTTGGTCGTGCCTCAGCATCGAGCTCGCGCCGAATC
TCCTGAAGACCTGCTCTTCGTACACTTCAGCCACATCTTGCGCCGTGGTGGAACTCATGGGTTTACACATGACGAATCCTGAGAACGCATCCTGAAAAAG
CAGCAGGAACATGTTCCCACGGTCCGACTTAGGCAAGTGTGTCGCGAAATCCATAGACACAACTTCAAAAGGGCGCCTCGGTTCGATGTTCCCAGGGGAA
GGCCCTGGATTCTGGGGGCGCCCCTTGCCGCTGGCGCAATCAACACACTCTTTGACGAAAACTTCCACATCAGCGTACATGCCGTGCCAGTAGAACTCAG
AGCGCAGCTTCTCGTACGTCCTCGTGATCCCCTGGTGCCCACCCTGAAAATCTTCGTGAGCGTAATGCAGGATATCGGGTCGCAGAGCTTTCGGCACCAC
GAGTCTGAGTTCGTCAACCATATCTCGGGGTCGATCTCTGGTAGACCGACTCAAGCGGTACAGGACTCTGGAATCCAACACGAAATCATCAGCGACCTTC
GCGAGTTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGCGTCTCCTTTCAGGAAATCCTTGAGTTGCAGCAGGTGATCATCTTTGTCCTGGTGCACCTTGA
TGCGTCGCCAGCGTTCCGCCTGGTACTCCAGAGGTCCCATGGGTTCGCTTTGGGCTTCGATCTCCTGAGTTCGCGCCCGAGTCATTACTGCAAACACTTT
GGCCGCCACAGGCAACGGAGCGCACTCAGGTCCAGGGTTACCCAGAGTTTCGACACCCTGAGAATCACTCCCCTGAATTCCAACGTTCAATAACACCTTC
GGTCTTACCAACTTCTCGTGAATCTTGGACACCAACTGCAGATGTGTTCGTTCGTCAGCATCCTCCACCTTCCAGGATACACCAAGCGCGAGGGTCTTAG
ACGTCAGGTAGTCTGCGGCCTGGTTAAACTCTCGCTTGACATGCACCAGCCGCACAGACTTGAACTTCGTCTTCAGCACTCCATACTCGGCCAGCTTCCT
CTGGAGATTTGGCTGATTGCAGTTGATGAGACCCTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACTACAACGATGTCATGAATTCCACGCTCAATC
GCCAGAGTGAGGCCCTTCAGAAGTCCATGATACTCAGCGTCGTTCACAGTCACGTCCTCCAGGGTGAATCCCTGGGCATCCAGGATTTCCCACCCGAGGA
CATGCCATAGGATGCAGTCGCAGCTCCCTTGTCGCGTGGAAGTCTTAGCGGCGCCATCGAAACTCAGAATACACCCCTCCTAGTCCGCTTCCAGCATTTC
CATACTGATAGGCACTGGAGGTTTAACGCGCCCCTTAGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGGGTAATACCCGCACCCAGA
ATTGCAGCCAAGCCGTCTTCATCCCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGACT
GTGAGGTCAGCAGCCACTTCAACACAGAATATCGCGTGTAGACGACGATCTTAGGGCTGCCTTCAACCAAAGTGCGAAACACCTCCAGGACTCTCAGGAT
AGCAATCACCTCCTTTTCCGCAATGTGATACCGCAGCTCAGCGTCATTCAGGACGCGACCTGCGAATCGAACCGGGTGCACAATCCTGTCGTACTCCTGA
CCCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAATAATCACGAAGGGCCTTGAACGATCAGGATGTCTGAGTAACGGAGTCGAAACAATCTTGT
GCTTCAGGATTTCAAAGGCTTCCTGGGCTCTCGACAGGTCTCTCCTGGATTTCACTTGTTCCTCAGTCAGCTCGTACAGGACGGCCGCGATCACGGGTAG
ATCTTCAATGACCTTGTTGTAGTAATTCAGACTCCCCATGAAACTCTGGAAGCCTTTCAGTGTCGTCGGGAACGGCAAGTCTTGGACCCCCTTCGCGATT
TCAGGGGTCGCTCGGATGCCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATGGACAACTTCCCGAATTCGCTCTTGGGAAGACTCACAGAGATAATCC
AGTAACGTAGTCGGAAGAGCAGCGCGTTCAGATCCTGGCACAGCAGCTCCCATGTAGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAG
GACAGGGCCCATCTGAGAGGGAGCCAGGATGTTACGCTGAAAAACAGTCATCTCATCCGTCAACACTGAAAGTCGCGGTGCATTCTCACCTGAAACTCTG
GGTTCCCCAGAGTTCAACCCCAAAAAGTCCAAGACATCTTGGTCGACCTCAGCTTCTTCCTCAGAGGAAAGCCGCAGAAATCCCCACAGACAGTTATTGA
GAACTGCCTGGTAGATCAGCGGCGCGTTCTTGAGGTCAAACGGCATCCTGACCCACTGGTAGTGCCCATAGGGACAGACGAACGCAGAGATCAACTTGGC
TCTCTCGGTCATCTTGATAGCCCAGAAACCACTCGCCATGTCCAAGCTCATAAACCACATCGCCGACTCAAAGCCAATCAAAAGATCATCAATAAACGGC
AGCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGATAGTCGATACACATCCGGATGTCGACCCCATTCTTCTTGAGGACGATCACGATTGGAG
ATGCCCAGGGGGACGAAGAAGTCTCGATCAGCCCGTTCTCCAGAAGCTTCTTCAGAAGTTCATACACCTTAGTCCACAGGTGTGGTGCAA