Description :
From Genome Similarity Track
Location :
Scaffold_2777:222- 2512
Transcript NameFunction/comments
Phypl_g15379hypothetical protein PHYSODRAFT_257054

Sequence
2290 bases(100 bases per row)
CTCTGGAAGATGAGGTGAAAAGCGGGCAAGGGCCCGAAGAGAGAGCGCCGTCGATTGGAaggtcgtcgacggcaaGCGAGCTAGGAGAAAGACCTGCCGC
GTCGTGGAGTTCTGAGGGAACCTTCACGACAGGCCATGGGGCCAGCGATGAACAGGAGGCGTACGAAGAACAGTTCGCCGTTCCCGATGTGGCTCCCACC
GGAGCCACCAAGGACTTCGATTCTCATCGAAGTCCTCCCGGCCTGAAGTCTGGAAAGACCGAAGGCCAACAACCATCCGCCACGAAGGCTCCCGCCAAGC
GCAAGagccggaagaagaagaagctgcgcgctcCGGACTCAGCGGACGATCTACCGCTCAAGCCCAACAAAGGGTTAGGACGGGAGTATACGGCTGAAGA
GCTGGACTACGTCCTGAGTCGCACGGAGCTGTTCCGACAGCTTGAACGCATCCCGATCTTGAGCTTCCTTAAGCCCAAGTTGATTGGCGGCTTCACTGGC
CCCTTCCTGAAGCCGGACCTCGCGAGTCTCACGAATGTACGGCTAGCAGTGCACGCTTTCTTCGCGATGCTTCGAGAGTCGGGTTTCATGTTAGGCGCgt
tcgagatggagaaggtgtaCGACTGGGACCTCGCTGCTTGGAAGCATGCGATCCAGGCCTTCCTAGACCCCCTGACCGTGCTAGTCGGGACggtcagcga
cgagaagcccCCTCCGCGAAGAGGTCGAGCGCCGGCTCCGATAACTGCGGCATCGCGACGATACTCGGCGAGCGTCGGCTCGGATAGAAGCATCGAATCG
CCTAAACGAATGTCGATGCCTACAGCCTGAGCCACTCGagtcgcgcagctcacggTTGCACCGACACGAGCGTCACCGAAGATGAACCCGGAAGGGACGA
TCCCCAAAGCGCTCGAGGATGCAATCATCCGATTGACCCAGTCCACCATGATGCGAGACGCcgcggcgccagcgacgcccGCACAGCCTACGGCGGTGCC
CCAGCCGGCGGAagccgacgtggccatggagTCCATAAGTTCCCACTCCGCCTCCAGGCACAAGCGCGGCCATGACGAGGACCCGGACGATCTGTTTGAT
CTGGACAATGGCACACCGGGAGCTGCGGCCGCGATTtcagccacgacggccggcGCGGGTATCTCTCGCGTCCGTctctcggccttctcggagTTGAAGG
AGTTCCACAGACGAGACGCCAGCGAGGTGAAATCCAGAGCATGGCTAAATCGAGTGAAGTCAGCGTCGCGCCGTGACGGTATGACCAGGAGCGAAGTCTG
TGCCTCGTTCGGAGACCTGATGGCTGGACCCGCCCGCCAATGGTATCTGcagctgaccaagaaggtCCGGAAATCATGGCCGGACTTGATGGATCAATTC
TGTGTCCAGTACTGCGGCAAAGGCGTGTCTATGACGAGTCGCTATTACCATGTGACTAAGCATCCCGATGAAGCTCCCTTGGACTACCTGTACCTGCTTA
ACGTCGCCGGAATGCGGGCGAAGATCCACTACTTGGACGGCACCACGGAAGGGAAAAGGGAACATGTGGAGTTATTCATCGCCACCCTGGGTccccaaga
gcaagagctggCATCGCGACTCACCTTGATGGAAGTGCCTGACACCCccacgctggagaagaaacTGCGCGCCAGACAACGTGGGCTGTCGCATCAGAAG
AAAAAATTATTCGGGTCGAACAAGTTCAGGCAGAAGGTACCAGCTCCGCCGCGGCCGGCCTGCGCATTGCAAGCGATCCAAGCCACGCCAGACGGGTATA
ACTCGGGACGTGAGAGCCAAGCTAGTGACGATTCGATCTGTGACCAAGATCGGGATGACGATGAACGAGCGAGATTGTTCGTAGCAGGTCAGACGCCGCC
GGGAGAAATCGTCCGACGCGATCTGGGTCAGGAAAACCCGGGACGGGATCGCCCCCGATGCCGCTACTGCGGCTCGCGACGCTATTCCGACGACGATTGT
TGGAGTCTCCTGACGTGCCAGAAATGTAATGGTCACCACCCCCACCGACTGATGTCTGCGGGCTCGCAAAGCTTGCGGAGACGTGCATGAAGCGGGAGAG
TGTCCTTTGGAAGAGTTCTTCAACCAGCTACGACAGTGGTATAACCCGTAGAAACATGCGgggatgctgccgccgacggcCGAAAAGATGTTAAACTAGA
TCGCTCGCTGGGTTGGAATCCAGTACGGGACTAGCGATCTGTTTCCGTCAGTGGAGTAGCCCCCTCGCGTAAATCCGCCAAGTCGTCCTC