Description :
From Genome Similarity Track
Location :
scaffold_1915:222- 2228
Transcript NameFunction/comments
Pl_100243hypothetical protein PHYSODRAFT_410384

Sequence
2006 bases(100 bases per row)
CGCAGGAGCGCCGCCAATGACACGGAGATCGACTCAAGCATCTCAATGACGGTGCTAACACCTCCCTGCAGGTTGTGATCGGTGACGCGATTGAGGTACC
ACTGTGTCTCTACACGGGGTCGGACCACAATGTGGTACCTCGGCGAGTTATTGAGCAGGTCTAGGGATTGGATGCTGGCGTGAGCGTGCGGGTGGATGAT
CCACCGCTCACGGTGATGACTGTAGGTGGAACAGAAATGGTCTGCGGGGAAATAGCTAATCGAGATGTATCTATTCACACGGCTGATGGACCTGTGGTGT
TACGCTCGTTAGATTGCTTGGTACTGGACGCAGAGGAGCCTGAGTTCCTGTTGGGATACCGTACCGTGAGGTCGTTAAGCATTGATGTTGGGCGACAGAT
GGAGCAGCTAGCTGGTGGAAATTTGGCTGCTGAACTTGATGGCGATGGTAACTTGCCCTTTAAACCGAAATTGATTCCAATGATGAGACCGGTCAAGTAA
GGGAAAACATCAAGTTAATGCTTGATGAAGCAGCCCGGGAGGCTGACGATGACAAGTGGGCTACAGAGCTCCATGCAGTAGTGATGCAATTTGAAGATTT
GTGGTGCGTGAATACAGGATCCGACCCACCTGCGGATGTGGGACCGATGCGTGTTAAACTCGTGGAAAATGCTCGGCCGTACCGAGCTGGTACCCGTCGC
TACTCACCCGACCAACGACAATTCCTACTGAACAACTTGAACAACACGGATTAGTGAGACGCAATAACGAAAGTCGTTGGACCTCGCCAGCACTGTCTGT
GCGCAAGCCTGAAACGGATCAATACCTCATCACTGTGGATTATCGTGCGGTGAACAGGATGACGGTGCCTATTGCAGGTGCTACGCCGAATCTGGCAACA
GTGATCAACAACGCTGATGGGGCCGTCGGTTTTGGTCAGTTCGAATTTTCATCAAGGGTTTTTGGCAGCTCCGTTGTTACATGAGAACTGTCAAGAATTG
TTCAGTTTTGTGACTGAGGACGGTGTTTTACACCAACCAGTGTACCCAAAGGTGCGTGTGATTCGGCGTTGCATTTTCAACTGCAGATACATGTAAGCTT
TTAAGGCATGTTATACGCTGCAGTGCAGATATGGATAGATTATATTTTGCTTTTCGCCAGAAGTAAGGCCGAATACGTTGAGAAACTGGGGCAGTTCTTT
ATGATCCTTCGCAAACGGGGACTCAAGCTCAATGCGTTGAAGTGCCGATTATTTGCGCGTAGTGTGAGGTGGTGTGGGAAAGTTGTGTCTGGAAAAGACG
TGAAGTATGATGTTTCTCGATTGTCGGAACTAGTAAACATGGAACTACCTCCTACTGCTGCTACGTTGCAGCAGTTTTTGTGCGCGGCCAATTGGGTCTG
CGAGATTGTCGTAGATTATGCTCGAGTGCTTGCTCCTTTGCAAGTGAATCTGGAAGAAGTGACGGCAAAACGAGGACGTCGTCGTCAGCCGTTGACAGGT
GTAAACTTGATATGGACTGAGGAAGAACGACAGGCATTTACGGACGCTACTACTGCTTTAGAAAACTTTTCCCCGTTGCACTTCTCGTCAGAGACAACGA
CCATCAATCTTTTCTGCGATGCAAGCGTTCCTGGATAGGCCATGGTGCTTACTCAGATGTTGTAATGGGACCAAAACCTTGAGGTGGTGGAACAAGCTCA
TCCGCTATTAGTGTATCAAGGTGGCACGTTCACAAACAGTGAGCTGAATGGGAGTGTAGTAGAAAAAGAGGCGTACCCGATTATTGTTGCTTGTGCAAAC
CCGTACATCCTCGAGCGCTCTGCTGGTTTCCGTATATTTTGCGATCGCGCCAATCTCATCCATCTCTTTGCACCTCATCGTGAATTACGTCAATACATCC
GCGGAAAGCTACAGCGTTGGGCTCTCAGACATCCTGGATTTCGTTATACTATCGAACATGTGAGCGGTGAGTCCAATGTGTGGGCTGCTTTAATATCGCG
ATGGGC