Description :
From Genome Similarity Track
Location :
Scaffold_107:221981- 225203
Transcript NameFunction/comments
Hyaar_Emoy2809710kinesinlike protein putative

Sequence
3222 bases(100 bases per row)
TGCTGACTGAAGCGTTGCGTTGGCATGGGGCAGCACAGTCTTCTGTTGAACGCGTGTCATTATCGAAGGTGCTTGGAATGCCATCGTTCGTCCTCTGGCG
CTTGCGACCAGGCTCAGTACTGCTTGGCGAGCTGGTACGGCTGGTCGGGTTGGTCCTACCATCCAACTGCAGATCTGAAAGGTTGGTGGACTTGAAGGAT
GGAAACGGTTGGTCATCCTTCTTTGTTGGCGTGAATCCTGATCTAGCATGGATCTGGATAAAACAACGCAAAAATGTGCGACCAGTTAGTTACACAGCGC
GAAAACGCAATGTCAAGCGGGTGCCCACCTTTCGTTTCTTCATGTACGCTTCCATGTCTTGCAGTTGCTGGTTCGATGCCACCGTAGCTTCGCCAACAAC
GTCCTTGCCAAGCGCTGAAATGAGCTCAACCTTGCCTTTTGTGTTTGACATCTGAGTGTGAAACCCTTCTTCCAGTGCCTTGCATCCCCCGTTCAAGCGT
TTTCGGAGCTCTTCGTGTTCACCTACAAATTGCACCAATTGTTCTCGCCTCTTCTTCGATGTTGCCGTATGAACCTGCAAGTGCTTTTCCGATAAAGAGG
TGACATCCTCCGTGTGCTTCGTTGTAAGATCACCAGTCGCGTTGCACAATGTCGTCTGCAGTCGTTCGTGTGACTGGACCAGCTTCGTCTGCTGTGCATT
CGTATCTGCAAGTTGATCTTGCATTTTGGAAAAGCGTCCGCGGAGCTCAGCTGTCTCACTTACGTGTTTCGCGCTTTGACCATCCATCGCTTGTAAGACC
CCCTTCACTTCCTGCTCCGTTAGGGTCTGCACGCACGAGATTTGTTTTTGGTGATGCTTCGCGGTTTCTTCAATAAGCAGTGTTTGCTCGTTAAGCTTCT
CGTTCTGGTTTTGGATACACTTTTCAATGTACAGAGCAAGATTTTCCTTCAGGCCACAAAGCTCTTCTTGATACCGAACGTGACTGGCTCTTAGTGCAGC
CGTGAGCACCGCCTTGCTTTCATCAAGCTCCTTAACTTGTTTCTCGACCGACGTGTCAATTACTGCTTGTAACTCATGCAATTTCGTGCTTTGCTCTGCC
AGAAAGGTGGTCAGCTCTGCACGGGAACCTTCTAGTGCCGACTGCATAATTTCTAGACACGACAAATTTCGCGATCCAGAGTTTGACACACTCTCAATGA
TAGCTGCTGCGTGGGACTTGGACATCTTGACGAGCTTCTCGAGCTGCTTCTGCACAGTTTGCTGCTGCTCTCTCGTCGAGGTCGTCACTTCTTCACACTG
TTTCAACCGTTGAGCTTCATCTTCAGCGAGTAATTCAATTGTCTGCAATCTGTGCGCTCCTACGAAGCCTTCCATCGCGTTCAAACTCGTGACAAGTCCG
TTTAAGTCCATTGATTGAGTCGTTTGCAACTCGTGCAGAGAGCTTGATACATCATCAAACATTTTCTCTTGAGTCTGCTTGTGCTTCGCTAGTCGCTCCA
AAAAAGTGTTGATCTGGGACTGTGTGGTACTACGATACGTAGTCGCAAGTTCTGTGTTCATTTCTTCTGTGCGCTGTGTGCTCTCTACAACAACAAAAAG
AGCACAATCAGGTAAAATTAGCACACACCATCTGAGAAGTACGAAACTTGCGTACCAATCTTTGTCAAAAGCTGGGCAGCCTGTTTTGCCCTCGCGTCAT
ACAGCTTCGCAGCGATAATTCCATTTGCAAGTAAAACTTGCTCGTTATCTTGGAAAACTTTAAGCGCAAATTTTACGCGCTCTAGCTCATCGGACATTTT
CACCACCGTTTGTTTTGTTGAAGCAAGTTCGACTTGTGTTGCCGCCAGCTTGTCGCTCACCTCTTGCTTCGCAAACATAACAGCCGCCACTTCACTCGCA
TTCTTTTCGGCAACTTCCTCTAGCTCTTTGCAGGACGAGTTTCTTGCCTTGAGTATATCCTCGAGCTCCATCAATTGTACAGCCTGGCCAGAAAGTCGCT
CTTGCATGTCGGTATATTGTTCCAGCGGGAGGTACACGCCGTCTTTTAGTCTAGCAGCACGCAAGGCTGCGCGAAGTGTCTCAATCTCGTTCTCAAAGTC
GTTTAACAATCCGGATTTGGTCATCTTTTGGTTTAGTTCAGGCTTATTCTTGATGTGCTTCGCACGGAACGCATACTCCAGCGTACTGAGCGTCTCATCC
AGGCTATCTGCACACGGAGCGAGCGTTGCAATAATCGTCGTTTTTGCCCGTCCTCCGAGAGACTCCTGCAACAAGCGCGTAAGCTTGCTATCGCGGTATG
GAACGTGTGGGAGGTTGTCAACCAGTGCTGTGATAACTCTTCCCAACGTGAGCAGACTCTGATTGATCGTGCCCGCTTCGCGCGCTCTGGCATTGCGAGC
TCCCGATCGACCTACGCATTCGGATCCAGCAAGATCCACCAGATTCAGCTGTCCAACGCGTAGTAGATCCTCACCTGCTGCGTTATGTTCCTTGCTATGG
ATCCGAATCGTAAAGATACTATGCGAGCGACTCGAGTTCTCGTTCATCAATGTCTCCGACGTGATCCGGTTCTTGACGCCAGTATAGACTAATTCATACA
CGTGTTTTGCTGTCGTTGCGGTGAGCTCCAACAAATTCACGCAATAAATTCCTCCTTTCTTGGCATCTTCCATTAGCCGGAGCTTCTTGTCTGTATCAGG
ATCTAATAAATCCTTCAGCTCTTCATTGTAGAGCTGCAAAAACGAGACACGGACGCTAAATTCTTCTCCATTGGCTTCCAGCGCGTCAAAAATGCACTGC
ACACTGCGCGGAATAATACCGGCTGTCTCACTGCCTGGAGTCAGATCTCCCTGCATCGTGTACGTCTTGCCTGTACCTGTCTGACCATAGGCAAACACAG
TACAATTGTAACCAGCCAGCGCCTCGTCCACTGCTGGTCGCACGACTGCATCAAAAACATCTTTCTGGGTCGAGTATTGGCCAAAAACACGGTCAAACGT
GTACGTTTTGCGCTTCACAATCGCCACTTCGCTCGAGTGGGGCTTGCATTGGACGACGGCGCCACGTCCTGCAGCCTTCTCACGGCTGATAAGAGGACGA
CAGCGCACTGCGACCTGTACGTTCGTTGGTAATGAAGGCGTCAGCGATGGATTGGGGGCCTCGTGGTTGCTGGAAGAAGAGGACGACGACAGGCGGCGGA
GGTCGCTGCTCGACTCCATTGT