Description :
From Genome Similarity Track
Location :
Scaffold_72:22196- 24151
Transcript NameFunction/comments
g13584.t1hypothetical protein

Sequence
1955 bases(100 bases per row)
GGCGTTGCGCTGGTCGTGGACGACATCAGCAAGGGCTGCAATTTGGCGTTCCGATACCCAGCATCTCCGTCCGAGAACGTGTCCAGTTTCCACTCGCTGC
CGGCCCCTCTGTTGGCCAAACTCTTCCGGCCTAAGAATGCGCTCTGCAACGCCAGTTTCGAACTCGTGGTGGACGATCTGCGCTTCGTGAGTCACCCTGT
GTTAGTGTCGCGTCGGCTGCCGGCTGTGGCGCCAGCGGACGGCCCGGGAAATGGCGGAAATGGCTCAACATCGGCTTCTGGAGTGTCCACTACAGTAGTA
GAGCAATCGACGAACGGCTCTACTGCCACAACGGGGAACGAGACGACCATGTTCAACGTCATTTTTGCATTGGAAGACAGGCCCCCACAAATGGCGAGAA
CGGCGGGACCCCTGGACACCACTTTTGACACGCAACTATTGCCTCTGCAACAGGCAGATGAAGAGGAACTTCTGGCCAGGAGACGCAGCAGTGCTCAGGC
TTTCCACACAGTAGCGGCGCAGCTATCCAATGGACTTTTGCACGAAGAGCTTCGAGTGGGTTTCGTGTCAAAAGAGGTGCGGGAGCTGCTGCAGTTGAGA
GATGAGTTGGCTCAGAGTGAGAGGAACGCGGGCAACAACAGCAATGGAATTCCAGGGGTGACAAGTGCAAATAGTGTGAGTGCAGCGGTGGCAGCCGGTG
CGACGAGCGGCAGCAGCATCACGAGCAACGCTGGGGGAGCTGCGACGACCGGATCGAGTTTGATGCACCATCATCTCCATAGGAAGGACGGAGAGAATGG
ATCGTCGACCGTGGAAGTAGATCCACAGACGTTGATTGACGTCTCGTTGGGGAAGAGTGTGCTGGCCAATGACCTGAAGCGGGTGTTTCATGGGCTGGAA
GAGTCTGGGGCTGCTCACGTGGTGCTGAATGGGTGGGTCAAGTTGTCGCTGACGTTGACGGATGCGGTGACGGTAAGGATGGCGAGCTTACGACCGTACC
ATACGTTACTGCTGCTCGCGGACAAGGACAGCATTCTGAACAAATTACCGGCAGATCATGCGCGTCAACTGAGAGACTTGGTGGAAGCTGTGAATCCGCT
CAAAAGCTTTCAGGATTTGGCCCTGGAGACTGGAGTGCCGATTCACCAGGTCTTCCGATTGGCCGCACATCTTGTCTACTGGGGATTTGGTCGCATTGTG
GACGCGATCACCCTGTACAATATTTACCAGGTCAATGCGAAGGCTGATCTGCATATAACGTCGCCGCTTGCTCAGGAGTTTCGGCGCAAGTTTGCTCCGT
ATGAATTGGGCGAAGTGCTCTCAACGTTCTCGGGGTCTCGTCGTATTGGCGAGTATATGAAGACTTTGTCCACGGCCAAGAAGACAGAGTACATCCACAT
GCTTATCTGGTTGCTGCAGCAACGCTTCATCGTGCAGCTCCACCGCTACATTTATTTTATGATCCCGTCCGATGGAGACTACGCTGCGGAGGTCGGGAAT
GGTGCATCTTCGGTTGGAAGTTCGTCGCCTGCACTAATGGCATCCAGCCTGCGACGCCAGAGAGTCAATAGCAGCGCTACGAACACAAGCGTCCCCGGTA
GTTTTCCGATCGCACAAACACCACCCATGAATCCAGCTGCCATGGCGCTGCCATCACCGCCGGCAGCACCGTTGGAACCCTCCAATGAGAATTCTGCAGC
AGAAGGACGCGGAGGCAGCACGATACCGATGGCACAGGTAATGAGTGTGGCTAGTCAATTGCTGTTCACAGACCAGGAGCGCGCGTATCTGGCCAAGATT
GCCAAGCCCAACCCTGTTTTCACGCTGTTCAAGCGGCTGTGTGTGTACTTCCACGGTGAGCACCACATTGAAGAGATCATGTGGCGCGAGAACCTCTCAC
GTGGTGAACTGCGTACCGTCATGAGTACGTACCAGGACATCATCGTTTGCTGTCT