Description :
From Genome Similarity Track
Location :
Scaffold_3:22194- 24456
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-fgenesh-gene-0.3Pre-mRNA-splicing factor SF2
Pytap_DAOMBR444maker-pag1_scaffold_3-fgenesh-gene-0.15RL38, ribosomal protein 38 60S large ribosomal subunit

Sequence
2262 bases(100 bases per row)
GCACCAACACCTTCGACAGTCACCATGGGCACTCGCGTCTACGTCGGCGGTCTTCCACGCGACGCCACCTCGCGTGAGATTCAGGACGCGTTCAACCGCT
ACGGCCACATCTCCAACGTCTGGATCGCGCGCAACCCGCCAGGCTTCGCGTTCGTGGTGAGTTCTCCGTCCTCTTGATCTGCATCTTCGATCAGCACGAC
GGCAGCGAGATGACGGGAGAaGCGCcACTGCGCGCTCTGGGACACTCTCTCTACGGaCGCCCGCCTTGCGCTCTTGCATTCGCCGCTCCTCGTCATCCCA
CCCCCTCCTTGTACGCCTTGTGGCGTCGCTTCCTCCCCcGCTGGTGCGTTTCCCTCCGCGACGACATGGGTACTTCGCCATCTCGGCTCTCCCTTCGTGC
CAATGCATGCATTTCCTCTTCGTCCTTGGGGTGGACACGACGCCCTGCGCTTCTCGGGGCCCTTCGCTGCCGTCGATCGCCTTGCTTGTCTTCTTCGCCT
CTGTCTCTGCGGGATCAACCAACGTCGTCTCTTCGCTACGCCTTCGTCGCTTCATAGGATTTCGAAGACCCTCGTGATGCCGACGATGCCATCCGCTCGA
TGGACGGCCGCGACTTCCTCGGTGGCCGGTACGTCAaTTGTACTTTGTTTGAAaTATGTGAGTCTATCTGACAGTTGGACTGTGTTTTGCAGTATTCGCG
TCGAGCTGGCCAAGGGCGGCAACCGCCGTGACCGTGGTGACCGTGACGACCGCCGTGGTGGCGGCCGTGGCGGTGACCGCTTCGAGCGCGGTGGTAGGCA
ACCCTATCCGTGCTATTCGAGACGAATCTTTGTctGACGTTGTGTTCAATATGGCGCAGGCCGTAACCCACCACAGCGCACCGACTTCCGTGTGCGCATC
ACGGATCTTCCGCGTGGTGTTGATTGGCGCGACGTGAAGGATCACCTCCGCACGGCTGGTGAGGTTACGTTCTGTGATGTTCAGAGTGACGGCACTGCGT
AAGTTCAACTGTTAAGGTGGGATGTGCAAACATCAATGTGAGAGTAACATCTCATGTCATGCTGTAGCATCGCTGAGTTCCAGACGCGCGATGACATGGA
CAACGCCATCTCGAAGCTCGACGACAaGGAGTTCCGCGGTTCGTACATCCGTGTCGCCGCTGCCTCGGAGGAGGgCCGTAGCCGCTCGCGCTCCCCTCGT
CGTTCCcGTTCGCCAGAaCGCCGTtCGCGCTCGCGTTCGCCACGCCGCGAGTCTCCACGTCGCTCGCGCTCGCCGTCTCCGGCGGCTCACTCGCCACCAC
CACGCAAGAACTCAGTGTAAATCGTATTCCACGATTTtCCGTTGAGGCTCTGGTGTTGGGACGCATGGCGAAAAACGCTTGTAGTTTTTGGCTTAACTAT
CAACATGGGATGAATGGAACGACTGCTGATGAGTTTGTGTATCTTGTGCCTCAGcTGTGCCTACACCAAGCTTCACATGCTCAGGTTGGCAATGACCAGT
ACCTCTGAATCCACAACTCTACTGCCTTTAGCAAGCACGTCTTCGTCATGACAtGGGGTTGACCAAGTGCCCATTCACGACAGAGAAGCATCCGTCCAAG
AAACTCATTTGCcACGTCTCGTAAAGCCAtGAGTGTTTGTTGAGACTACGGCAAGTGTGCTGagAATGCGAATAGGGTGACAGGACAaGGGAAAGATGAA
GCTAATCGAGAGCAACGCCAAGgCGACAAATAGAAGAACCAAAGGCGGATTAGCTTCCAACCCAAAAAAaTCTCCTGCATTGATGCAATGACTGCTTCCT
GAGACTGTCGAAGCCCTGGAAGGCTGAATGCCACAGCGACCGAGCCTAGAGACTATCCGGGCCACGCGACGAAAGCAGTAGAAGACCGCGCGTTTACTTA
TGCCGCAATCCgAGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTAGAATTGGAGTGTCAGTgAaGATACATGCAATAGAGAGAATCAACAGTAACG
AACCTGGTGGCAGGGACTGGGTGAGCTTGTCAGCCTTCTCGGTATCCGTCACGCagAGCGTGTACAGGTACTTCGAGCAGCGGATCTTGAACTTGACGAC
CTGGGCGGTCTTCTTGATCTTCACCGAGCGGGCGTCCTTTCGGCGCGCCTTCTGAAGGAAATCGCGGATGTCGGTGATTTGCTTTGGCTGCATTCGACAC
ATCGCTAAGTCAGCGCCTCTGTTGCACATGATCGTATCATTGATGGCGCGCAGCAGCGAGCA