Description :
From Genome Similarity Track
Location :
Scaffold_98:22193- 42090
Transcript NameFunction/comments
Phyag_g2016hypothetical protein PHYSODRAFT_313196
Phyag_g2017hypothetical protein PHYSODRAFT_465114
Phyag_g2018hypothetical protein PHYSODRAFT_313194
Phyag_g2019hypothetical protein
Phyag_g2020hypothetical protein PHYSODRAFT_493289
Phyag_g2021hypothetical protein PHYSODRAFT_369743
Phyag_g2022ABC transporter ABCF family

Sequence
19897 bases(100 bases per row)
AGCACACGATCTCGCCGTCCATGGATATTTGCGTGTCCAGCAACTTCGAGCGCTACCTCTTTGCTTTGTCCGGTGAGAACCATGACGTCCTGCGTGGCTG
GATGCAGGGCTTCGAGGAGACGAGCGAGCTTACGATCTCGGGCGACCTACTCGCCAAGGCGCAGGACGAGATGGCGTCGTAcgcggtgctgcagaaggaa
gTCTGCTCCACCATTGCCGAGTACAAGAAGGTGCACCGGTACCTCTTCGACCCGCACAGTGccattggcgctgctgccgctatGCACTTCGGCCAGGACG
CACTCGCCGACAAACCCAACTCAGCtgtggtcgtcgtcggcaCTGCTCACTACGGCAAATTCCTGCCCGTGGTGTCTCAGGCGCTTGGAGTGACTGAGGA
AgagatccagcagcaccctATTCTCAAGGCGCTCGAGTCACTCCCCACGCGGCTAGCGGTCGCCAACAATTCGAGCGCTACCGTTGCCGAGCACATCCGC
AAGACTATTGCAAAGAAGAACCAGAAGTCACGCGGTGAGTGCTTCAGCTTGTGGACGTCGGCTCCGACCGAGTGCAAGTTCGCCACTGTTGCTCTTGCGG
CAGCAaccattgctgcagtgctctTCGTGGCTCGGCGCTCGAAGTAAATGATGATAGTGGGGTGGTATAACCATGCCTAAGCAGCAGACTTCATCCCTCA
TGCGCATTATCTTAGAGAGAAGAACTCACATCAACATGAAAAACGATGAAGAATAAGTTATCGTCGAAGGCTCACTTACCGACAAGGAGATCACTACAGC
CTTGCATCGAATATGACCTTATACTGAAAAATGCACGTTCAACGCGTGAGCCTGCTTCTATTCGACCTTGTACCCTTCATCTTCCTTCTTACATTTGTTG
ACTTCATCTGTAATTGACCGagttggcgaaggcgaagccGGGTTGCCAGTAGGTAGCCTGATGACCACGAGGCAATCCGTTCATCATCGGCCCGGCGGCT
ACAATATAGTGCAGTTACCTGCGCAGACACCACACTGCGGCGTCTGGTTCTGTGCGAGATACGCCTTCTGGTGTTGTCGCTGGAGACTTTCACGTGTGAC
GGTGACAACACTCGTAGATCCAGTTTTCGACCCATTCGTAGGCGGCCGGAAGCTTTGCTGAGAGGGTTTTGCCGGTTCTTTCGGCGCAAATGAGATCCTC
TCCTTCGTGTACTGGTTCTCGTACGAATATTCACCCGGTCTGGTCCTTGACAGAACACGCCGCCAGCCTGGTGGTAACCGCGCAATTTTCTTCGGCTCAG
TCGGCGACAGCAAACGCCCCACAGGCACAATCAGCTTTTTGAAGGCGTCAACGACATTAGTCGAGTCCAATGCTGACGTTTCCAGAAATTCCATCGAGTG
TTTGGCCGCGAATCTCGCCGCTTCGAGCGTCGACACCTCCCTGCTGCCTGGCAGGTGGGCAAGATCGCATTTGTTGCCCACAAGGATCAGCACCAGACTC
TCGTGCGAATGTTCATGCACCTGTGCTAGCCACCCCGTGACGTGCTCGAACGAGCTGCGATTCGTAATGTCGTACACGATCATGGCACCCACTGCGTTGC
GGTAGTAGGCAGCAGTGAGCGACTGGAAGCGTTCCTGCCCTGCCGTGTCCCAGATCTGTGCCTTGagtcgtcgatctccgacTCGAATGGTCTTGGTCGC
GAACTCAAAGCCCACGGTCTGCACGCTGTGCGGCATGTATTTGTTCTTGGTGAAGCGCGTGACGAGGTTGGACTTGCCCACGCCCGAGTCGCCGATGAGC
ACCACCTTGAGGATGGACTCGGCCATGggcgacgagcagcgcggACTGTTGGAGGCCGACATGGACGACCCTCCGGTGGCCGAGATCTTGGAGCTTGCAT
GGGTGGCGGGGCTATTGGACCCACTCTCCCGTCCGCCGTTGAACTGCGTGGAGCTGATGGAGCGCCGCaggtcgtgctgctggtggaagacctggtgctg
cgccacctccttgGCCGAAATGTACTTGTGCAGAggattgctgttgttgttgctgttgttgttgttgttgtcggaggaagaggacgaggacgccgtggtg
gtcgacgacgacgccagcTCGTGCTTGCCGCTGGTGGTCATggctgcagtgtcgagtGAGAGGAAGCGGCTAAGATCGCGTGTGGCTTCGGAGCGGGCGA
AGGCGACACCTGGCAGAGAGCCTCTTGAAGCGAGCGAGAGAAGCTTTCAAGCGAGCACGACGTCGGAACAAATTCCGATCGCagcatacaaaaatcaagt
cAAATAGTAATATATCAAGGAGGACACAATGTGGACGCATGTGGACATACCACTACGACTTGGTCAACGCAGCTCCGAATGCGATGCTTCCGGTATAAAA
AAATTGGCTTCGCACGGGCCAAGCAGCCATTCCCATTCCTCGCCACGCGGAGAGTCGCGGCTGCGATGGCTGGCAAGGCCAAGAGGAAAGCTCCAGCTCT
AGCGAACAGCGCTCCTAACGCCAAACGAGTCACTCGTGCtagcgctgcagtcgagaaGGACATTCGACCACCAGTGCACACAGCCGATGAAGCTTTAGCA
ACGGACACGGGCAGCTCTTCCAccagcaatagcagcagcaggaagatcGTCGCTTTCCTTCGCGGCGTGAACGTCGGGGGGCGCGTGCACAGCATGAAAT
CCATCGCCGACGCATTGGGCAAAGCAGGATTCGCCAACATCAAAACGTTCCTTGCGAGTGGGAATGTCATCTTCGATGCACCTGTCGACAGCTCCAAAGG
CGACGAATCCTCGGTGCTCGCCATCGAAACCCGAGTGGAAGACACACTCGAGGGGCTCTTCGGCTGCCATATTCCAGTGTTCGGTCGCTCTatggacgag
gtggcgcagcttcGCGATCGGATCACCAAGTCCGCAACGGCTGTGAATGTAGTGCTCGTGAAGGAGGAACTGACCCAGGAACAACGCGATATCGTCGAGG
CGCTCTccaccgacgccgacgagctTGAACTGCTGGACAAGGCGTTCGTGTGGTACTCAGCCACCAAGATTAGCGAGTCTCCGCTGTTCAAGGTGGCCTT
CGACAAGAAATTGGGTATCCCTGTCACGGTTCGAACTGTAAACACCATGCGCCGCATCGTCAAGAATTTCGGCTAGATCCGCGGTTGTTTTTTGACGTCC
TGCCGAGCACACCAACGAAAATGGAAGCAAACTCACGCGAAAACAATAGCAACAAGACCACAATTGAGCAGAATTACCTCGAGTACACAAACTGGGTAAC
AGTGTGCGGTGAAACTTCAAAATCCGCACCGCTACAGTAGTTTCACCCAGTTCTCATATGATCTCTCTTCCATGTCGTATCGACTTGAGGTCTCTCTCAA
TAATGATTTGCCCACAGCAGTATCCTCCTCTCGAATTACGACGCCATTGTTCACATCATTGCCAGGTTCGTCGCTATCCTCCGTCTCGTCATCCGGCAAC
AAACTGCCAGCGATCGCACATGTGTCTATAGGCTCCTTTTGCTCAGTATCCTCGGCAGCTGCGTACGTATAGATCTCCGGAGGTACTGGAGTCGGTAACT
CGCTGATCTCCATCTTAAATACTCGAGCAAGGAGGTTAACTCCTTGCACTTCATTCCTCGAGAGAAGAGTTACTGCCAACCCTTTCCCACCAAAGCGGCC
AGTCCTCCCAACACGGTGCAAGTACGTTGCTGGATCCCGCGGCAAATCCAAGTTCACCTGACAATTCACAAGTTAACAATGCCACTATTAGTTGCCAACA
CCTCATCCGCTCATTGTGCTTTCAGTACGTACCACAAAATTGACTTTGTCCACGTCAATACCGCGCGCAGTGAGGTCTGTAGACACCAGCACGCGCAAGT
GGGACGCTCTAAATCTTTCCATTACTTCCAAACGGGTAGCTTGCGTCTGGGAGCCGGTGAtacacgctgctggccaacctTGTGCTGCAAGAGCCGTAGC
TAACGCCTCAGCCCGAAATTTATCGTTGCAGAACACCATGCACTGCACAAATACGAtctccgacagcagcgatgccaGCCTTACCACTTTCGCGTTGATA
TTTAATACGTCATCTCctgatggtggtgcagaCGGCGACTTGACAACACTGTAAAATTGCTGCACATGGCGAAGCCAAAGCTCCGGAGCATTTGATTGTT
CTCGTGTCTTCCAGTTTTCGAGGTCTTCCGCGGACGAAATGAACTCGGTCGTGACATCACCTGGACCTTGAACTCGCACGATCTGAAcggccaagcagca
aaataTGGTGTGGGTCATTCATTGCATAGAACATCATACTCGGCATCGCGCTCACCTGTGGAGTCCTCATTAATTGCGCTACAGCAACTAACTGATCCGG
AGTAAAGGTGGCCGAAAACGCGAGTGTCTGCATCAAAATGTTGCTCTAGTTAGTAAGTACAGGTACTAGTACTCGGAGAGCATCGGTGTAACTTGGGATT
ACCTGCCGCCTTTCAGGGAGAGCGTCTGCGATGCAATGGATCTATAGTAAAAAAACGTAAAAATGTAATCAGTAGAAGTACCTGTTGAaccaactgctcc
accatCGAACCAAAGCTCATACATCTTTCTCAAAGTCTCGTGCCATGAGTTTGTCCACTTCATCTAGCACCAACAGCCGAATGGCACTGCACGGCAGTGA
ACACTGGTCCACGAGAGCTTTTACGCGACCTGGCGTGCCGACCACAATATGGCACCCTGCGGCTAAGTGCATCTGCCCAACACACGCCACTAATTAATAC
CACTAACTACTATAAACACTATATCATCTTTTCCATTTGCCAGTACCTGGTCTTGGGCCATTGGCAATCCACCGATACACGTGCGGATGACCATCTCCGG
TCGAAACTGAGCCAATTGACGCAGCACAGACTCGATCTGCACCGCGATCTCTCTCGTAGGCGCAAGAATCAGCGCTAATGGGTCTCCCAccatcacctcc
tcctccgtctgtTGACTCCGCCGCTCTACGTACTGAATCGCGTGCTCAATGGCTGTGACTCCGAAGACTGCAGTCTTGCCTGTGCCCGACTTGGCCTGAC
CAATGACGTCGTTCCCGAACAGAGCCACGGGCAATGCGTGAAGCTGGATGGGCGAGGGCCGCAGGAAACGCATGGCAGTCAGAGCACGCCCCACATCGCC
ATGCAGCGGGAGGTCGCTGAACGTCGTCAGGCTGGCGGTCAGCACCGTGTCGGAAGCCATCACAGCGCAATGAGCCCTAATCGGGATTAAGTAAGCTAGA
GCCACCGAAACAGTAGCCATTTcgtcacacgtcgcagacAGTTCGACTTCAAGCACTTAACTCGGGTCCAAGACCTAAAGCGAAGATTAGCTCGCCACGC
CGACCTCCAGAGTCGGAGTTGCTAGGGCTATGCGTACCATTATCGAAAGATGTGTAGGCGGGCAAAGAACACAAATACAAACATGCTAGGAATACTGAGT
TAAAGCGCTTTACCGTTCGCGCAACATCTACGCAGACTTTCGCTATTGACCTACCGATCATTGTATATTGTTGAGGTCTGTGAGCTGATTACGAACACTA
GAACAACCGCTTGCCATTGTTCTGTCCACAGGAAGGCATGCACAATTAGGACAAACTCATTCGTTGTCAAATTGCACTAACTACCGACATACGCTACCTA
CACTCCGACCAGACTTCAACTACCAACACTCTTAACCCACTGCGCAAAAACGAAAGACATACAATAGGTTCTAGAACGAAATGTTGATAACGTCAGCTCA
AAACTCGATTGCTTGCGAGTCGGAGCGGCTGGGATGAAAGCACTGCCAATGACTTCCGCCCGCCTCTTTTCATATTCATCGTACATTTTTTTAAAGCTGA
TGCCCCAATCAATGTACAGCGACTGCAGAGAAGATGTCGCTGCTCTCCACTTTCTCTCAGTTACCTATCTGCGCCGCGCCAACCATATCTCCATGAAGGA
CTGGCGCGGCAACTGGCGCAGGCGCCCACCGCGGCTTGCAAGGTTGTCGCTTGGACAACGGACCATGGCTCGAGGGTGAACCAGGCTTCACCCACACGAC
GGAGGGACAAGGCAACAACGGAGTCGAAGTTGGGCTACAGCACTTCAGCTCTTCAGCGGCTACGGCCATGAAAAGGCAGTCTTAGGATCGGATTACTGTA
GCGCTTGGATGGGGCTGCAATCTGTGCTGCCTAGCTCAGCTGATGGACCCCTTGCTTGATGTTCGTCTCTGGGCGAGTCGATTGTCGAAACCTCGCTATT
CAGATTATGATGCAAACTTCCGTTCTCCGGGTCTGTTGCCTGTTCTTCGCTGTTGGGGCGCTCTGCTGAAAACTCTACGCTGGTGTCATCCTCATGAACT
GGGCACCCACGGTATTGCCGAGATTGCTTTCGTGGCGAGAGTTGACTTGATCGTTGTTGATTTtgcggaggaggcgctgggcTTGAGGGTGGCCTCTGCT
CACTGATGCTGCCATCTTCTGGAATTTGCACTTGAGGCAGATTCTTTGCGCTGGTTTCAGGGATAGTTGTGGTAGAGCTTATATCTCTAGATACAAGTTT
CCACTGCAAGAGTGTtccatcgtctccaccagcagtcaCCAAATATGAATCGTCGAACGAGAAGCCCAACGCTGTAATGCTGGATGAGTGAGCTTTGTAG
ACCTTCCTCTTAGCACCACGTGGAGCAGGGTACTTGAGAAGATGGACACTTGATCGACAAGCAACGGCCAACAAGTCTTCACTCGATGTCGACTGCGTGT
TTCCAGAATCACCGCTTTCACTACCAGTCTTTGCGCCCGTCGTGCAGACTGCAGCAATGTCCACAAGGTTAGGTGACTCCTCTGACCAGATACCAGGTGT
AGGCCAGCCAAACACGCATGTCCACTTAATCCATCGAACGTCGCGGACTAGGAAAGCGTCGGTAAGCTGTTTGGTTTCGCCCTTCGTAGGAGATACTAGC
CAATACAGAATCTCACCATCAGCTGCATTGCTTTGAATGATGTCGCCGTCCTTGTTCCACGTTAAATGCAGCACTGCGCTTGAATGACCCTTGCAAATAT
GAAGCTTTTTGTAGCCGTTGGGAACGTCGTAGATGTACACGAATGTGTCTTTCACCCCCACCGCCAAATATTTTGCGTTCGGGCAGTATTTTACCTGCGC
GATCGCTCGACTTCCTGGACCTGACAGTCCAGAATGAAGAGTTGGAGTACTACTCGAATTTGACTTAATCTTTTTCCGAAGCGATACCCTGAAGACGTCA
CAGTCTACAATCAACAGCTCGCCTGAGCTGAGCCCAATCGCAAGTTCATGCCCAGCAGGATGGAACTCCATACAAAACACTCTCAGGCTGAAAGTAATGA
AACTTCCAAGGTACAACCGGCGAGTACACATGTGCTGTTCAAGATCCCAGAAGCTGAGATATCCATCCTGTGAGACCGTCGCTACCACTCCCGTGCTTGG
GTGTGTTGTGCAGGTTGCTACGACGCCGCTGCGAGCTTCAAAGAGCAACTGCCACTCGCCGGAAACAATATTAAGCTCCCATATGCAGCTGTTGTTAGTG
GCAACGAGTACGAAATTGCCGTCATCTTTCCAAACAATACTCGTGGGCTTGGGCGCGGCAGAAGCACCGCTCGCGCTTATTTCGTTTGGTAACATTGTCG
GTACTTGAAATATCTTCTCGGAATCATCAAGCGGGATCAATGCATGTGAACCTTCTGCAAACGTCCCTGTTAGTGGTGTGAACACCCCTTGAGTATTAAC
TCCAGGTATTCGCATGGGTTTACTCATTTGGCACGTCCACAGTAATAGCTTCCCGTCGTGTCCACAAGACATGACCATATTGCGCTTTTTGGAGTACGCA
GCTTGGTAAGCTGCTCCTTGGTGAGCTAGCGGTCCACTATACTTTAGTTCACCCCAACGCGATTGCAAGGCAGTCGCGTTAGGCCTCAACGCCATTTTCT
TTGACAATCCTTCCATCTCTGATTGAACTTGCTTAGGGAGCTTAAAACGATTCCCAGTTTCTTGATCATGTGGTACGACATCAACGAGTCTTCCAGTCGG
CTCGAATGCGATTTTCTCCAATACGAGTTCATTGATTTCGGCATCAGTGTATTCATCAGGAATTTCCCACCATTTTGCTGGTTCTTTGTGTAAGTTGTGA
CCTGAGGCGATATCGACGTCAGGACTCGCTCTTGGCTGCAAGAACAAGCACAAATCTCCTTTAGCTGTGCCAGCTATTATCCGGCCGAGTGAATGATCCG
TGGCATTCGTTGCAatcagctccttcatgttCTCATCATACATGTAGAGAGGAGGAGAGTCGTTCACAAATGCCAAACTGATAAAGTCTTGGACCTCAAA
ACGTCCATGAAATGACGGGACATTGCCCTCCAGTTTCCATACTTTCTCGGTTGGTGTTGGAGGACGCAATCTTGGAGGACCACCAAACGTCGAGCGATAG
AAAGCACTGTCAGCGTTCTCCTTTGATGGTGGGGGTACGTAGTCAGCCTTTGTAAGCGTCCAGAAGCGAATGTGCCGAACGCCACAGCTGACTAAAGTGT
AGCAagcatcgtcgtcgtgtAGGGCTTGTCCAGGTTTCTTTGATCGATATGCTTCCGGCCTGCCAAACGCCTGAAACGGATTGAATGCAACCGAATGCAC
TCGAAATGTGTGCCCTCGAGCGCTAACCATTAGTTCTTGTGCTTTCCAGTCGTGGATGCAAATTGTATTGTACATATCTCCACCCAAGGAAGCAATCAAC
TTGCCGTCGTGAGAGAAGCTGATAGATCGCACAGCAACATGATGGCCCTTGAGGTACGCGAATCGTTTTCCTAGAGGTTCGTCGTTCGCATTCCACACCA
AAAGAAACGCTGAACGCCCTGCTTGTCCTGAAGCAACAATGCGCTGGTTCGGATGAACCGCCACGCTCGTAACTTCGTTGGTGTGCTCTCGAAAGAATCT
CTGTGTGTTGGTTTCTTTTTTGTATAACACcacaagtgctgcagcaaaccaCATTACCTCGCCGGTTGATAAATAGAatgcgctgctgttggcacTTGCG
TTgggagctgcaggatggctACTGGACAGTGATGCCGTAGTCCCACTACGACATCCATACACAAAGTCCAGTTCTAGCGATGTTTGAGGTGCTTGATGAG
CAGTATTTGCATCCAAGCTGGACGAATCTTCACGATCGTATTCACTCGGAGCAAACACATTGCTACGACACTGTGGATAGTGTACCAATGCTCGCTCGTA
CATTTGTGGTCTCTGCTGCGACAGAATCACCTGTGCTCCGTCACTGCGTTTTTCGATATGTGCAACACGAGGAAGGATTTTGTCTGGCCGAGAACCAAAA
AGCAGTTAGTTCCACTTTACGTGCCACACTATCAATCTGCACAATACCCATACCAAACTCGATCTTGCCGGTCGGGCTGCGAGGCCCTGGAAGTGTGGCG
TTGGGCAGGTGACTGCTTTTGGGAAGTCCACCACTAATCCTGCATGAGGTTCATTCAACCAAAAGTAAGCAACGCGTGGATCCCAGTCTAGTACACAAGA
TGCTAGTACTTTGGCAGTTTAGGGggcgaagcagcagtcgatgGGACGATATCCAAGGGCGTGACGACGGGGTGGATGTCCAAGGGAgttttcttgagct
tggacgaTTGTTTGGCGACGCTGTTGGACCACGAGCGCTTGGAATTGACAGTGGCCGCCATGTCCTCGAACTCTGCCAGCACTTTGGCCATCTGCTCTTT
CATGGCTTCGAGCACGGACCCTCGCTCTCTCAGTTGgcgctccacctcgtccgaGATTAGGGTCGTGAGCTGGTCGGGAGCCACTGCGCCGTCATTTCCG
CCTGCGCACACACACAGCTCACACGTCAATAGTAGATCTGCCAGCAGTGCCTAGTAGTCGCGCCTTCCTTACTCATGGGCGTCGCTTGCCCTTCGTGCGC
TGCCGTGTTGAAGTAACCACCCAGGAGTGAAGGTCTGTTTCGTGTGTGCCGTACATAATCCTTCCCGAGGAAGGATCTCTCACTTTCACTTTAGCGCAAC
AGGAGGAAAGATGCGCGGGaacgaggacaagatcgcgcagctgctggacaaggtACGCGTATCGTGCGCAGGAATCTATTAGAGTGTGAAGCTAAGCTGG
CGTCTGTGTATTTGTGGAGACCACGGACTTCGACAAGGATGAGCGATACATGGCCACATCGGATCTGTGCGTCGAGCTGAACAAGGACGTCGAGCTGGGG
GCGTATCTGGAGCCAAAGTTCGTGGGGTTTTAACTCGTTTTCATCATTTTAAGGGCTATTTGCTCACTTTTGCGtctgcttgcgctgctgcagagtgtgT
GCGGCGGTGCTAAAGCAGTTAGACGACAAGTCGAACGACGTGCAGTCCATCGCCGTCAAGTGTCTGGGCATCCTGGTCACCAAAGTGCAGGTGGCTCAAG
TGGCGGATATTTGTGCGAAACTCTGCGACCTCATTCTCAACGGCAAACCGGAGCTTCGGGACATCTACTCGATCGGACTCAAGACGATCGTGGCGGACGT
TTCCCAGACGACTGGGGCGTCCATCGCCACTGGCGTCTGCACGCGACTGCTGACGGGGCTGAGTAAGGACAAGGACGCAACTGTGAAAGCTGAGACGCTG
GACATCCTTACGGACCTACTGCGCCGCTTCGGCTACGACGTTGCCACGGAACACGCGACGATCATGGAACTGCTGATGGTGCAACTTACCGATGACTCGC
CGCTTGTGCGAAAGCGTGCTACAGCTTGTGTTGGGTCGCTGGGTGTCATGGCGTCCGATGTGCTCATCAGTCGCTTGGTGGAACACCTCATCAAGGGGAT
CCAGGGATCTACGGACTCAGCAAACGTGCGCACATTAATCCAGACGATTGGCATGCTCTCGCGCACTGCAGGACACCGGCTTGGACAGCATTTGGACGCG
GTAATCCGCATCTTGGTTCAATTCTGTGGAGATCCCGAGGATGAATCACTGCAGAACGAAGACTCGGATGAGCTTCGCGGAAACTGCTTCCAGGCGTTCG
AGGCATTTATGATTCGATGCCATAACGAGATCACCCCTCACGTGGAGACTATCCTGAAGCTCGTGATGCAGTTTATTTCATACGATCCCAACTACAACTA
TGTTGACTCCgccgacgaagatgaagatatggaggaagacgaggaagagtacagtgacgaagaaggtgattacagtgatgacgacgacaccagCTGGAAG
GTTCGTCGCGCTAGTCTTCGCGTGCTAACTGCAATCATTACGACAAGGTCGGAGCTTCTGGAGCAGCTCTACATTCACTGCGCTCAGCTTTTGATCTCGC
GCTTCAAAGAGCGAGAAGAGAACGTTCGGATTGACGTGTTCGGAGTGTTTGCAGAACTTCTTCGTGCTACTCGCAAGACATTTCCGACCTCGAATGGAAG
TGGATCCTTCCACCCACCCACATCGAATGCGTGCATTACCCAGTTGGAGCAGCGCCTTAATGCTATCGTTGTTGGCGCCAACAAACAGTTCGGAGCGAAG
GCCTCGGTTCCATCGCGCTGCGCTGTGGTCGCGATGCTGAGTGAGCTTGCGATGGTAGAGCATGGAAAGCTCGGAGATTACATTGGTCGCTTGATGCTGA
ATATTCTGAACGCGGTGGAAGACAAACACTCAGACTTAAAGCTGGATGCACTATCATTCCTCCGGCTGCTCGTGGATACCCACACACTGGAGCCGTTCCG
AACTCACATTGATTCGATCGTCAAGGTTGCAGTACAATGCGCGAAGGGAGATTGGTACAAAACGGTGGCAAAAGCGCTGGGGTTGATTGAATCGCTTGTC
CGTATTATCGGATCAGCCGACGGGGATGTGGTGTACAAGACGTATGCGGTGCCTTTCTTTGAAGCAGTATTGCCTAGTTTGAAGGTGCACGACATCGATC
AAGAAATTAAGGAGGCTGCAATCAGTAGCATTGGGGAGATAATTGCTGTGTTAGGTGGGTGCATTTCTGATCtgtgcaatgctgctgctgctgactgctT
ACAGCTGCTTCTGTGATTAACTAACTGAGCTTTTGTTGTGAAAATAGGTGACGAGCTCGGCCCACGTGTCGGAGAAGTGTATCCACTGCTCATGGAACGT
CTCAACAATGAAATCACGCGAGTGCAAAGTATCAAGGCCATTGGAGTCATTGCTCGGTCAAAGCTCAACTTGGATATGTCGCCAATTCTCGTGGAGTGCG
CCCAGACTTTAGCCCAGCTGCTTCGTCAACAGTCTCGCACGTTGAAGCAAGCTACGCTGGCTACACTAAATGACCTGGTTGTCCACAAGGGTGCTAGTAT
GCCACAGAGTCTACCCTGTGAAGTAGTGCAGGAAGcttcgcttcttcttgtcgacgtGGACCTTCAATTGTGCCGTATGAGCATCACATTGGTGTCAAAT
TCTCTTCGTGTGTGTCCGCATGTTGCGTCAACGGATGCTTTACTGCAAAATGCTCAAGTAAAAGCACTGGAACTCTGCCACAGCTCTATGCTTCAAGGCC
CCACATTGGATGACCTGAAGGGCCTTTTCGCGCAGCTAACGCAGTTAAACTCTcccggcagcagcttccctgATCTGTTTAAGGCACTGATGGCGACCCC
TTCTGAAGAATCAAAGCACTCAGTGCTCAACATTGCTCGGTGCGTTGCCGGCACGTGCGTGGCTACGACGGAGGAAAACCGGAAACTGGCCTTCGCCAAG
TTCGTCGGCGATATCACACAAACGAAGTCCGAAAAGAACAAAGTATTGGCACTTTACTGCTTGGGCGAGTTTGGCCGCAAGATTAAACTTGCTGGTTACA
CTGACGTAAAGGAGACCATTCTGAAGTGCTTCAATGATGCGGGTGAGGACGtgaaggctgcagctgcgtaCTCGCTTGGCAGCATTTGTGTCGGCAACAT
GGAAGAGTATCTGGATACCATCAtggtgaagctggagcttggCGAAAACTCgtatctgctgctgacgtcaCTGCGTGAAGTCATCTCTGACCATGCAGCA
ATGCCACACCATGGTTTTGCCATGTATGTGGATCGTGTCCTTCCTGTTCTGCAAAAGATGAGCgctcgtcaagaagaaggggTGCGGAACATGGTTGGCG
AATGCATGGGAAAGCTGTCTGTGACGGACAACGCGAAAATCATGCCGATTGTAACGGAACTATGCGGATCTTCAGACGTGTGGTCCCGCTGGACCGCTGT
GACGAGTCTCAAGTACGCAATGACGACAACCGCCCAAGAACCAATAGTCAACGCAATCTTTGCTCACATCGACCCCTTCTTGGCTGCgcttgaagacgaa
gatctgcatgtgcgtcgtgctgcgttgctggtgctcaacACGGCTGCTCACCACCACGCGCACTATCTGGTGCCGTACGTTCGCGAACGCATCTTCCCCG
TGCTTCTGAAAGCGACTGAAATTAAGTTGGAGCGTGTGGTGGATCTTGGTCCGTTTAAGCACAAGGTGGATGAtggtcttcctcttcgtAAGGCGGCGTA
TTCGTGTGTGGACACGTTGATCCAGGTCCTGCCGCAACAACTGGACATCACCTTGTTCTTTGACCAGCTGAAGCGAGGCTTGGGAGACCAAGATGATATC
CAGATGCTCAGTCACCAAATTGTGATCAAGATTTGCTACGTTCAACCTGGCAGTATCGTGGGTGCGTTGGATTCATTAATCGACCCCCTAGAAAAAacga
tcaacaagaaggTGAAAGAAGACCAAGTTGGGCCCGAGGTTGAGCGCGTCAAGGATCTCATTCGCAGCGCGTTGCGTGCGCTCGATGCGATCAGCACTGT
GCGTGACACCGACTCCCACCCGAGACTAAACACTGTGATGGagaacgcgaagaagcacaagatgCTGGGTCCACTGCTAGAGACAATTCGGAGCGAACGT
GCGAGTAGCTGAGCTCATCCAATCAAGTGACAAGAGAGCAACGCGCTGAGGATGAAACAGTGAGTGGTGATTCACGTTCAGATTAACGACGCTCTGAAAT
CGATTTCATAGTTCGTCCTGTGGTTGGAGCTTCGCTGATCTTTTGCTCAAATTTCTCTTCTTTCGATGAGGTTTTCTAGTTCCCATCGTGTGTTGGCTGT
GTTTTGAGTAAGCCTTGCCGTTCCAATCGTACTCTTTCACATCGCGCTGCTCATCGAGAAATCGCATGACATCGTTGACAAAAATCCCCTTCTGCAGCCC
AACGAGCAATTTCGAGTCTGCAATCTCGTAGATGTTGACTTCGACTCCACCGTTccacagcagctgcagcgtcacacAGAAATAAGAAGTGGAGGGTGTT
TGCACGCCGTTTGATCTGCTTTACTCACCTCTTTCCATCGTGTTGCGACGTCAGGAAGGAGTTCATTTTGACCGTCTCTCAGCGTCACGAATATCATTTG
GGGCCCAAGcgccttggcctcgtcctcgttccTGAAGAAATGAAAAGGAAGTAGAAAGGTTGTTCCATGCTATTGCTGTAGCTCTGTATGGCGGCTGTAC
TCACTTGTCTGCAAGCTGTCGATAGCGTTCGTCTCCTTCCGTACGCAGTTCCTGAGCTTCGTCCCCCGCCTCCCACGATTTCTCGAGTGCATCATAGTCA
ATCGCCTTCGCACGGCCATACACCAGACCCGGGAAGCTtacaaggagaaggctgaccaacagcgccagcgaccATCGCATCGTGGACGGAGTTGGAACGT
CTAGTTTCCATTTAGACTGGATTTTCTTCATTTATTCCCTATTTTATCAGATTTTGTTATTGCATCGTTATTGAACAGCAAATATGTGGCTTCTCTCAGT
TACCTATCTGCGCCGCGCCAACCATATCTCCATGAAGGACTGGCGCGGCAACTGGCGCAGGCGCCCACCGCGGCTTGCAAGGTTGTCGCTTGGACAACGG
ACCATGGCTCGAGGGTGAACCAGGCTTCACCCACACGACGGAGGGACAAGGCAACAACGGAGTCGAAGTTGGGCTACAGCACTTCAGCTCTTCAGCGGCT
ACGGCCATGAAAAGGCAGTCTTAGGATCGGATTACTGTAGCGCTTGGATGGGGCTGCAATCTGTGCTGCCTAGCTCAGCTGATGGACCCCTTGCTTGATG
TTCGTCTCTGGGCGAGTCGATTGTCGAAACCTCGCTATTCAGATTATGATGCAAACTTCCGTTCTCCGGGTCTGTTGCCTGTTCTTCGCTGTTGGGGCGC
TCTGCTGAAAACTCTACGCTGGTGTCATCCTCATGAACTGGGCACCCACGGTATTGCCGAGATTGCTTTCGTGGCGAGAGTTGACTTGATCGTTGTTGAT
TTtgcggaggaggcgctgggcTTGAGGGTGGCCTCTGCTCACTGATGCTGCCATCTTCTGGAATTTGCACTTGAGGCAGATTCTTTGCGCTGGTTTCAGG
GATAGTTGTGGTAGAGCTTATATCTCTAGATACAAGTTTCCACTGCAAGAGTGTtccatcgtctccaccagcagtcaCCAAATATGAATCGTCGAACGAG
AAGCCCAACGCTGTAATGCTGGATGAGTGAGCTTTGTAGACCTTCCTCTTAGCACCACGTGGAGCAGGGTACTTGAGAAGATGGACACTTGATCGACAAG
CAACGGCCAACAAGTCTTCACTCGATGTCGACTGCGTGTTTCCAGAATCACCGCTTTCACTACCAGTCTTTGCGCCCGTCGTGCAGACTGCAGCAATGTC
CACAAGGTTAGGTGACTCCTCTGACCAGATACCAGGTGTAGGCCAGCCAAACACGCATGTCCACTTAATCCATCGAACGTCGCGGACTAGGAAAGCGTCG
GTAAGCTGTTTGGTTTCGCCCTTCGTAGGAGATACTAGCCAATACAGAATCTCACCATCAGCTGCATTGCTTTGAATGATGTCGCCGTCCTTGTTCCACG
TTAAATGCAGCACTGCGCTTGAATGACCCTTGCAAATATGAAGCTTTTTGTAGCCGTTGGGAACGTCGTAGATGTACACGAATGTGTCTTTCACCCCCAC
CGCCAAATATTTTGCGTTCGGGCAGTATTTTACCTGCGCGATCGCTCGACTTCCTGGACCTGACAGTCCAGAATGAAGAGTTGGAGTACTACTCGAATTT
GACTTAATCTTTTTCCGAAGCGATACCCTGAAGACGTCACAGTCTACAATCAACAGCTCGCCTGAGCTGAGCCCAATCGCAAGTTCATGCCCAGCAGGAT
GGAACTCCATACAAAACACTCTCAGGCTGAAAGTAATGAAACTTCCAAGGTACAACCGGCGAGTACACATGTGCTGTTCAAGATCCCAGAAGCTGAGATA
TCCATCCTGTGAGACCGTCGCTACCACTCCCGTGCTTGGGTGTGTTGTGCAGGTTGCTACGACGCCGCTGCGAGCTTCAGAGAAAGCATTTTACCAAGTA
CCAACGTGCGATTTTCCAATCTATGTTATCAGTCGGCATGAAATATGAACAAAACGGCGCGCCACAGCAGGCATCTAAATGAGCGATCAACTGACGAGAG
TATTTACTCCTCGGCAGGCTTGGGCTCCTTGTCCGCCAGCTTGAGCTGCTTACGCACACGCATCTTGAAGTCCGAAATCTCGCCCTGGTACACCTTGATA
GATTGGTTCTCCACCAGCCAAATCTCCTTGGCGACCTGGGAAATCAATCGCATGTCGTgactcaccagcagcatgcCACCCTTGAAATTGTTGATGGCGC
GAGCAAGCGCATCAATAGACTCCATATCCAAATGGTTCGTAGgctcatcaagcagcagcatgtgtGCGTTCTGCTGCGCCATGTATGCGAACACCACACG
ACTCTTCTGGCCGTCAGACAGCTGACCCATGATCTGTGTCTGCACCTCACCAGTGATACCGTAGCGGCCCAAGTAGCTGCGCACTTCCTCAACGGACTTG
GTCTGGAAGAGCGAACGGAAGTACTCGAGCGGAGACTTTTCCAAGTCCAACACATCAACGAAGTGCTGGCTGAAACGAGCAATgcgcaacttgctgtgtG
GCCGCACATTACCTGCAAGAGGCACCAGGTCACCAGTAAtgagcttcagcagcgtggTCTTACCCGTACCGTTAGCACCGACAAGAGCGACGCGAGAGTC
CAAGTCCAGACCCATTTCCACCCCAGCGTAAAGCACAGGGGAGTTCGGGTAGCCGAACGACACGTTCTGGAACATCAACACCggaggcggcagcggctcG
GGATTGGGGAACTTAAAGTCACCCGTCGCCTCAtgctccaccttctccgtAAGGCCATCGCGCACCATCTTCGCTAGCGTCTTCTCCTTACTCTGCGCCT
GGCGAGCAAGCTTAGCGGAACCGTGACCGAACTTAGCAATGTACTCCTTCATGTGCTTGATCTGGTCCTGTTCCCAGTTGTAACGCTTCATCTggttctc
ctccttttcAGCCTTCGTACGCACGTACGTATCGTAGTTACCAGCGTAGtactcgagcttcttgttggtgagGTCAATAATGTTGGTGCACACCTCGTTC
ATGAACTCCTGCGAGTGCGAAATCATGAGTAGAATTTTCTTCCACTTGGACAGGTAGTCCTCCAGCCACACGACAGCTTCCATGTCCAAGTGGTTGGTCG
gctcatcgagcagcagcaacgtcggcTGGATGAACAGAGCACGAGCCAGCGCGATACGCATACGCCAACCACCAGAGAACTccctcgtcttcttgttcat
catGGCGTCCGAGAACGTCAGACCCGACAGAATCTGACGAGCACGGACTTCGGCCGTTGCGGCGTCCATGTCGTCAAGACGCTCGTACAGGTCCGTGAGG
CGGTCCGAGATGGCCTCGCTGTCTTCCTCGCTGATGGACTCGTCCGTCATCTGCTCCGACAACTCGTCGGCCTCAGCCTGGAGCTTGTTGCGCTCCTCAT
CAACGGACAGCACAGCCTCAAGTGCAGTCATGTCGCTGGCCTCGATTTCGTGCTTCAGGTGGTAGATGTCGATACTCTCCGGGATGGGGATGCCACGCGC
GCCCAGTACGTTCATGAAGGTGGACTTACCGGAACCGTTACGACCAATGAGGCCGTAACGACGGCCGTAGTTGAGCGAGATATCGCACTCCTCCATGAGC
ACCTTACCGAAGTACGTGATACTGAAGTTGAGCACGTTAATGTCCTTGAAGTTCTTGTGCACCGAGCGCACGTTGTGGGAGCAGGTGGCAATGATGCCTT
CCTCGGCGAGACGGTCGGCGTGGGACATGTTCTCAAGCgcctcggccttctcggccgccttcttctcctcggccgccttcttgcgcgACTCTTTCTTTcc
cttgcgctccttcttcacgcgcggttccttcttctcgcggGCCATGGCTGCtatctgttgctgctgcttgagatCTGTAGCGGACCGAAGAGttgcaaat
gctgctgcttcgtaaGGCCGAGCTTAGCCAACCAATTTTTCTCGGAATCAAGCTTGACGGGGTGCATACGGCTCCACCAGGATATTCATTCTCAAATCTG
CTACATCTTGGTTTCAGTATTAGCGGCTTGGTTCAAAAATATCATTTTTCGCATCCCTGTCCGGCGGTTTTTTTTAGCGTCCTCTGCGCCATGCATTTGC
TCGCTTTGCGTTTGCAGCTGTACCGTATTTCGCATGTACACAATACACCCAAATGCTTCAGGGGTTAGATAACCCTGCAAACTTGATGATTCATGGACAA
CTCTATTTTTAGACTTTATTTTTAGAGAGTCGCtggctcgacgatgtcgtCCTGGCAACTAAAGTCTTGGCGTTCACCAACTGAATCGCCTTCTAGCAAT
GATAGGTTTTCTAACTCAGCAATCAGAGCGTTTCTGCGATGCATGTGGAGCTTGGCTGCAAATTGCTGGCGAGAAACCCGTTAGAAATTATGTCTACCGA
GAGCGATTCCCACGATTCTCGAATCCATCCACACATTTCTACTCTGTCGGGGGCCATGAGCTTAAACTTGTTCCCTGGGATACGGGGCTGCGTTATTTGA
ACTTGCGTAACCGTGCCTTGAACGGAAAGTTCCAGGCGACGCCTGCAGGCTGTGAGACGGACGTCGCTCGAGGTGGGACCTTCATTAGGACAACATTGAT
CGCAGCAGCGTATTGCTGCACCATGGGCGTCTGTTGTAGCGGATGCTACAGGTTCAACTCGTCGCTGGGATCCAgaaccagcaactgcagctgcaacgta
TATCTTTAGCCGAGTCGTCCTCGATCGAAGAGGGCCAATCGAAGGCGTGCATTTTCTAGTTCGTTCTAACTAGTGATGAATGAACTCACTTCTACATTTA
GCTCGAAGGCGACACCGAACAGCGTGCAATGTCCGCTAAAAGCATCCCACAATAGTAGGATGGGTTCAAATGGGATGGGGTGTTGTCCGAAGTGATGCTT
CAGAAATTGAACAGACAGATCTTGATTCCACCACCCTACGACCATCAAATTACAGTTTCACTTCAGTTAGTCAACAGAATCACCTCAACATTGATAAAGT
CATACCTTTTTTGTAGCCGTAGACAGCAAGGTCGTTGTCGGCTAATACGGTGCGCACACCTTGCCAAACACGTACTCCAAACCCATTTCTATCCTTGGTG
TTTTTTTCTTGAGTCACTTTCACAGTAGATGGTACCGCTTTCAGTCCAACAAACAGGGTGTAtttgttgccatcgctgtcacCTAGAAACATGGTGGTGA
CGCGTTCCTTTGACGCTCCGCTGCACCGTACCCAGAGAGTTCGCTCTCCTCGCTTagttgtcgtcttcttggctaCATACTCGAAGAACACCGCTGG