Description :
From Genome Similarity Track
Location :
Scaffold_41:22192- 24868
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_41-snap-gene-0.38Conserved gene of unknown function

Sequence
2676 bases(100 bases per row)
CTGCGATGGCGCGCTGAAGACAGTTAATTTGCTCTTCTTCTTGTTCCTGCTTCGTGAAGACGCCTGACACGGGCAGCGTGGATTCCGATGCTGGGTCGAG
GAATTCGACGGTGGACGCGCGCTTCGGTCTATCGGGCAGTGCCGGTGGCTCGTACTGCTCTTCCCAGAGTGTCTGTGTCGGGAGCAGCACACTGGCGCGG
AATTCGTTCCATGCGTCCATGGCGCCCTTGATTTTCAGGAACAGGTGCGGCGAGTGGGCTTGTGCCGTCGTCATGGCCTGGTCGAACGAGATCGCGATGT
CGAGAAAAGCCGGAGGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGGTCCCAAACGCACCCAAGACCGTCTCAAAGCAGCCGTGGAGCAGC
AAGTGGAGCCGCAACAGATCGTTCGCGGCGCGAAACGCAGGCAGCTCCTTGCCAAACATAAATGGCGAGTCCTCGAGCGCGACGATAAAGAGCCGCGAAA
TGGCGCAATGCAGGATGTTGGCGCCGGGGAACCGCGAGATGAGCGCCAGCAGACACTCCATCGTCTTGGTCGCCACAAGCTGCTTGTCGATGGCCGTGCA
CGAGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGCATGAGGTAGATCACCTGCACGTGGATCGTCTTGAAGTGCCGTTGGGGTGGCAGAT
CCAGGATCGTGACGAATTCCGAAAGTCGTGTAATGAATTGTTTCCACACCATAGGCAGGTCTTCATGGGGGCTGCCCTCCGTTAACGAGACCTGAACGCC
ATCTTCAGACGGCGGCGCATGCGAGAGGAACGCGGCTTTCGTGACGCAGCCGCATTGTGATTGCTGCAGCAGCGAGTTAAGTACTTTGACGGCGTAGGAT
TCGTTTGCGAACACCGTCGGCAGCACGCGCAGGTCCTCGGCCGCGGCGTCAATCAGTCGAGTCGCGAACTCGAGGCTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGATCAATTCTGTGCAAAACGCTTGTGTGGATGCGTCCCATGGGGCGAGTTGGTAAAGGAACTGGCNNNNNNNNNNNNNNNNNNNNNNCAT
GACGCCCTGTAGTGGCACAATGGAGTCTGGAAGGTCGGTCATCACGCGCAGCAGCACATCGCGGATCGGCTCGTAGTAGATGAGCACGAGCAGCGTCTCG
AGGAACGCGTGCTGGTGCTCGGCGCCAACGAACGCCAGCAGCGACTCGGGCGAGTATTGGTCCATGAACGTGTTGAGGAACCGCGCGAGCGCCTCGACGA
TCATCGTGTCGCGCGAGTTGCAGCGTGTGATCTCGACGCAGATCGCAGTGTGCCACTCGGTTTGCAGACCCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTGGCGGATGCTGGTGCTTGCAGCATGCAATTGATCAAGCCAACGACTATGGAAAACGTAGCACA
AAGTGTTCGCGTTAGCGCATGAACATGGGAGAAAAGCTGACGGTGAGCTACGAAACGTACGGTTGTCGGGGCGCATGAGGAACTGCAGCGTCGGGATGTA
CTGCTCCGAGAGCGACGCGACGTCGCTCAGAACCTCGGCGATGTCGTCCTCGTGGAGCGCGTCGACGATCGTCGCATGCNNNNNNNNNNGCGAGCAGCGC
GCGCACGCGGTCGTCGCTCATCGTCTCGCTCGGGATTGCGTATCAGGACCAATTAACGGCACGCTCACACACAATACGCCCTGCAAGANNNNNNNNNNGA
GCACTGCTGCTTCTAACTACGCGTGGCCGCCGCTAAGAAAAGCAGCACGCGAGCACGCACATGCGCCNNNNNNNNNNNNNNTTTTGGGGTGCGCTCTCTT
CAATAAAAATAAATACACTTTGCGCTATTTACAAACGGAACACATCGTCAAGTCATGGAGGTCCGACTCGTTCATTGGTTGAAATTATTATTTTACATTC
ATTTATTGGCTAAAAGCACATTTTAAGATTTAAGATTGGCTGAAACTAAAGCGTGTAACCCCTGCAACGTAACGACATAACCGATCTGGAGGTGACGAAT
CTAGAGGGGAAGCATGGCAGCGACAACGGTGGCGTCCACGGCGCGCGCGCTGCACGAGCTCGCGTCCTCCTCGTCCACTAAGCGNNNNNNNNNNNNNNNN
NNCCAGAGCGTAGCAGCGTCTTCTTCTTCCCCCACTGCTGCTGCTGGTTGCGCGCACTTTGCCAGCCACGCGCGCACGTTCGCGCAGCAGTATGCGCGTT
GGACACGTTCTCATGCAGCAACGCAGCAGCAGCACGACATGGAGCAGCGCGTCTTGGACAAATGCATGGAGCTGGTAGGATTGCTTGGTGCATCTGCGCG
TTTTCATGGTGCTGCGGGGGGCTGATTTGGCTTGCTCTGTGTTTGTGTAGGACCCAGTGGACTTGAGGACGGAGCT