Description :
From Genome Similarity Track
Location :
scaffold_540:2218- 3588
Transcript NameFunction/comments
g9095.t1hypothetical protein

Sequence
1370 bases(100 bases per row)
GGTGGTGAACAAATACAGGCAAACGACGGACTACAAACCGACCGATGCTCAAGTGGAGCCTCTCGTTGGAACAATGCCGAACCTGGATGTGGATCTGGAA
CGATTAGCGTTGGTATTAACATTCAAGTTTGACAACTAAATTTAGTTCTGAAGAAAATGCAGACTACATTTGTCGGATTCATCCTACAACTCTGGATTAA
AATCCAGAGAATACTCAGTGCTGCAAAACGATAATGGACGGAGATAAAGTGGTACACAACAAATATCCAAATAGAGGTTGAGCTGACGAGCGTAGTCTTT
GTCTAGTGACACGAGTTATTTTGAATATTTGGCGGGTTCGCGATCTGGATGTTAATTCGTTAATGAGGTCATGTTTCTTGCAACTCAAGACATCACTTAC
GACAGAAACAATCGTGGTTCAATCCAAGAAAAATTGTAAAAATATCGAAATTTATGCTCAAGTCTCAGCTGGAACGAAGATTGTGAGAACCGGGCCCCCT
TCGTTTCGCACGAAGTGAACAAAAACCAAGGGGCCAGCATCGTGAGGTTTTGAGGTTCGATTTGAGATCGTGCTAACCATCTCGAATATGTTTGAAACGC
ACGAACCTCTTCGTTCTTCGTTGTTACCATTGGTCACAGCAGGGGTTACGTTACTGGGTAACGGCGGCTCTTGAGCAAATGAAAGCTACAAGCTCCACGA
CGCATATACTAACATCTTCTTCGGGAATGAGAGACCCTGACGATCATTCGAACACGTCGACAGGTGCGTCTGCCCAACACGAGAGCAACCTTCAGTTGCA
AGGTCAGAATTCTGTGTGGAGCATCCCGGAGTACCAGCTTGTACAGAGGCGGCAGCTGATGATGCATGACGAGGTCACACTTGCAACCAACACTCGTTTA
CATCAGCATGCAGTTGAAATGGAGCAACGCATTGAAGCGTTAATGAACTCGGCATACGGCGTATTCTCCGAAGTCGAAGTGAGGCTCCAAGATCGCTTTG
ATCAAGCTTTAAGAGCAGCACACTCTAACGCGTTGTCAGCTTCAGACACGGCGATCACCACTACGGGTGAAAGGGTGGGGCAGGTTCGTCTCCAGCTGGA
ATCAGCTCAAGCGAGTTACGCAGCTCAATCTTGGGTGACCCAAGCGGCTGCTGGTGTGGCTCAATTACAAGTTTGTCAAGATCAAATAAATAAAAGTATC
GCGGCAACTCGTCATTGGATTGAAGAAGCAGTCACACGTCAGGCGGAGACAAGAATTTTCGAAACTCGGCAGCTACTCCAGAGCGAAATTGCGGCAGCAC
GAGAAGACGGAATTGATCGTGTCAGTCAGCTGGAGGCCTATATGCAGTCCAAAGTAGACGCAGCTTTAGC