Description :
From Genome Similarity Track
Location :
Scaffold_49:221725- 223805
Transcript NameFunction/comments
Physo_136911reverse transcriptase

Sequence
2080 bases(100 bases per row)
CATATACAGAGTCTCCAATCCATCGATCTGCAAGCTCCTTGCAGATCCATCACCACATTCTCCTCCCAAAGCGGCCAGCCCACTCCGGGGGGTTCCGGCC
TCACTGCTCTTCGTGAGACTGCATCGCACCGAACCGGTTCCGGTTGGTGCGACTCCGCAGGAACTCATGTAGTATAGATCCGCAGTTGAGATCCGCCTCA
TCCACCCAGGATGGATCTTCGTATCCACGCCAGTGTACCAGAAATTCACGGTGGATCCGGCCGTACCTAGCGCGCTTTCCAGTCCTCATATCAGTAATTT
TCTCCACTTCGTTCTCATCTTCACCTCGATCCTGGATCCAGCTGTCCTCCGGCAGTAGTGCTTCATCAAAGTCGTATCGCTCCGTAGTGCCTTCGGTCAA
CTGGATCTGAGGTCGGTCTGGGAAATTCCTCACAAGCTTCAACTTGGAAACATGCACCACGGGGAACAACCGGTACTCCGTGCCAGGGGTCTCGATCCGC
ACAGCGTATTCTCCCATCTTCTCCGCCACGCGGAACGGACCGTGCCACATATGAGCCAACTTGCGAGCATATCCCTCTTTCACCCGATCCAAATACAGAC
AAACTCTGGATCCAACTTCAATCTGGTGCGGACGGATCTCTTCATTGTGCCGGTCCGCCCGATCCGAGATCGCCTCTTGCAGTCGCGCGTTGACTTCTGA
CCGTGCCTGCTGATAATAGCGTTGGATCTGGTATCGCCACCGCCTCGGATCCCGATCCTGACGGCGAGTGCTGCCCACCGCGATCGTAGCCTCGAGCGTG
GATCTAGGATCCCAGCCATGTACCAAGTAGAATGGCGTCTCTCCTCGGATCCGATCCTGGGCGGTATTGAGTGCGAAGGTGAGACGCTCAGCGTAGTCGT
CCCAATCGCGCTGATCCAGATCCTGCACGTACATCTTCAGAGCGCGGGTGGCACCATGCGCTCAGCGGTTCCGTTTGCTTGCGGCCTGTACGCCATCGTC
GCACGTTGTCGCTGACCAAGGATCTTGTTGAAGGATCTAAAGAAGTCGGCCATGAACCCCGGCTCGCGGTCGTGGCGAATCACGTCGCTGGCACCAAATC
GTCTGAATACACACTCTTCGTAGGATTCCGCGATCGTCTGCGCCGTCCTGGAGTCGCTGGCCTTCGCGATCACGTACCCAGTGAGCAGATCCACCCAGAT
CAGTAACTCGGTATTACCTTTGTTGGATCTGGGCAGCGACGGTATGTGATCCATCGCTATAATCTGAAACGGGTACGTGGCTTGGATGTTACCGGGCGAC
TCACCTTGGATCGCAGGTCGCCCTTTGCCGGTTTCACAATCCACGCATTCTCCGATGTATCGCTGTACACTCCGATATAATCCTCTCCAATGGAAGCGAT
CCCGGACCCGCTGGTAGGTGCGGCCGATCCCTTGGTGACCTCCTTCGAGACTGACATGGTAATGGTGGAGAACATCCTGTTGTAGAGTCTCCGGCAGCAC
CAGCCTCATCAATCCATCGCGATCCGCCTCCGCCTTCTTCGCAGGAGGACTAGAACAGCAAGTCGTTGATCTCCACTTTGTAATCCATCGTGACAGCACT
ATAGGATCTAGCCTCATCTTGGGTCAGATCCTGCATATCGCCTGCTAAGTACTTCTTCAGACCGGAGATCCACGCCTCCTCGTCCTGCGCTTGGCGAATC
CTAGCGATCCTGAGGTCCCGCACTGCTTCCTCCCGTAACACAGTCGGGCTGGATCTGGATCTGGCGGATCCGTTTATCACAGGTGATACACGAGCGACGG
GAGCATCTTCCTCACTCTTCACAACCAGGATCTCCTCCAGTCGATTCAGCGTGACTACATCCTGCAGATCCACCGCATCCTCCACCATGATACCGGCCTG
CCGCTGAAGTGCTGCGCTGGCTAGGCTATCAGCGCTACCGTTCCAGTCGCGCTTGACATGTACCAGCTCATGATCTGGCCAGATCCGCAGCCTATCCAGG
GCCTTCTGTCTCGGAAGGGTTAATCCCGGTGCCTTGCAGTCGATCTCGCCTGGGACTTGGCAAACTACCAAAACGAGGTC