Description :
From Genome Similarity Track
Location :
Scaffold_18:221715- 223029
Sequence
1314 bases(100 bases per row)
ATAGTTGGGCAGACTCAACCATTGGCGTAGCTGTTTGACGTTCTTTGGCACAGGCCAATCGTCAATAGCTTTGACCTTCTCCGGATCAACTCGACACCGT
TCTTGCCCACAAAACATCCGAGAACAGGGATCTCGGGGTCGAAGAACATGCACTTCTTCAAGTTTGCGTAAAGTTTGCTTTCACGCATGACCTGGAAAAC
TTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAAAGTAACTCGGTGCGAATGTTCGT
AAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCATTCCCACAGCATACCACTAGGGA
TACTCACTACAGTTAGTGGGACATCGTCTTCGCGCATTCAAATCTGATAGAATCCGTCTTTCAGATCGATCGCACTAAAGACGGTGCTGCCAACTATTCC
ATCAAGGATCATATCCTTTCGTGGAACCGGAGTCTGAGTAGGAATAGTCGCGTCGTTCAGCTTGTTAAAAGCGTGAACAATGCGCCTCCGCCAGTCGCCT
TCTTCACACAGAAAGTGGGACTGCAATGCGGAGACTTGCTCTCCCGCACATGGCCAGCCTTCGCACGTTGCGCAAAGAACTCGTCGATTGCCTCGATTTG
TTCCTTTGGCAACGGCCACTGTCTTGTGATGCAGTACTTCGTACCAGGAAGTACGTCAATCTCATGACGAATGCCTCTATCAAATGGCAATTCGTCCGGC
ACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTCTTCTTGAGAGCGTCCCACGACTGCTCCTCGAACCTTTCCTTCCGTG
TCTTTTCATCGAGCACTTCAGCTTCCGTTGCTGATACTGTGCCGATGTCCTCTGCATCGTCAACATCGACGGTCATGCAGATCTGCGAGATTTCGCCTCT
CGCTAGGCTACGCTTCAGCGTCTTTTTGCTCATCGACGGCAAGGAAATCAACTCTTCGACCGTGTTTGGAGGATTTTCCACTTGTATGTGACGCATCATC
TTGACGTCACCTTCTTCATTGTAGACCGCGATATTCACAAATTCGCTCGAAGTGACTCTTGCTTGGACACTTCCTTCGTCATCTTGACTTGTACCTTGAT
CAAGGGCACACGTTGCGCTTGCAACACTTGACGGAACACTTTTCTTGCTGGTCTTCTTGTTCTCTTGGTGGGGTAGGACCCTGCCTTGATCCCCGGTCTT
CTCCTCATCGCTAC