Description :
From Genome Similarity Track
Location :
Scaffold_70:2217- 30032
Transcript NameFunction/comments
Phypl_g2346hypothetical protein
Phypl_g2347conserved hypothetical protein
Phypl_g2348hypothetical protein PHYSODRAFT_353505
Phypl_g2349hypothetical protein
Phypl_g2350hypothetical protein
Phypl_g2351hypothetical protein

Sequence
27815 bases(100 bases per row)
CAGCACTACCCGCGTCCGCTGAGTGAGAGCTACCATTGTCAAAGACTGGAGACAGAGCATTCGCCACGTCGGTGCCGTTCACGATCGCGCAGTATTCCAG
ATACTCAGACACGGTCGTTGGGAACCTCATACAGTATCGGCAACCTGCATCACCGATGCATCCTGGAGCGAGGCCCTCGGGACAGTGATCAGTGTCGAGT
ACAACGCCGATGCCTCCTGCCGCTTGACCGTCAGCCAGCGACACGTTCGCACAGAAGTCATCTTTCTCCGCCGACGAAAACTCATCCGACTCGTGGAGCG
CAACAGGTTTATCATCCAAAGCGCCATCCTTTGCTTGTGTATCATCAGTGACGATCGTCTTGAAGTTGATATCTGCTCCGTTGTCAGAGGAAGGAATGTC
GGAGCAGCTCATGTACGAGTGTGACTGCGTTGTCTCGAACCGCTTGCAAAAGCGGCAGATGGTGTCGACGCAGCCTACGCCTCCGTCACCGCATCGGATG
TCGGTAGCGATGTCCAACCCCACACTTTTGTCGCCACTAGACGCTTTTTGATAGCACTCCAACGGAATCGAATATGTAGATGCCGTGGAGACCGGGGCGG
TCGTAGGGGCAGCGGTAGTGGCAGGAGCTGTTGTAGCAGAGAAGCTAGTCGAGTAGTCCGAGCAGCTCTTAAAATGCGCCGACTGATCCGTCGATTTCGT
TTTGCAGTACCGGCACACGCTATCGATGCAGCCGAGTCCGCCATTGGCACAGCTCGCATCCGTGATGATGTTGATGCCGACCGAGGCGTCACCGGTTGAC
ACCGTCATGGAGCAGACGCTAGCAGCCGTGGCTTCGAAGCTTTCATCCGTCGTATTGGAAGCATCGGAGCTGCTTGTGGAGTCAGCATCGTAGCTCCCGT
CGGTGGAGTCTGCTGTGAGCATTCTCGTACTAGCTGGCTCCGAATCGTCAACAACAGGAATCGGCACAAAGGTGATGTCAGAGCCGACGGCCGCCGACGG
AATTGTGGAGCAGTTGAGGTACGTCTGCGACTGGACCGTGTCGAAGCGCTTGCAAAAGCGGCAGACGTCATCCAAGCATCccgcgccgccttcgctgcag
cGAACGTCCGATACAACGTCCAGTCCGACGCCTCTATCACCACTAGAAACTGTGCGGGAGCACTCGAACACGATCGAAGGGGTAGCTGCCTTTGTCGTTC
CCACTGGAGTGGGcgttggtgttggtgctggcgttggcgccTGAGTCGCGGTCGCGGTGGTGCCTGAAATTGTTGCGCAGTCCACATACGCCGCCGACCG
AGTGCTTGTGGTGACTTTGCAAAAACGGCACACGGTATCAATGCACCCCAGGCCGCCTGACGCGCAGGAATTGTCCGTCACAATGTTAATCCCAACTGCA
ACGTCGCCTGCGGCAGCGGAGATGCTAcaaacagcagcggcaatCGAAGTTGGAGCCGTcgtggctggagctgcagtggTTGGTGTCGTCGTAGTCGGTG
CGGGTGTTTTTGTCGGAGCCGCGGTGGTTGGTGCCGGAGTACTAGTCGGAACTGCTGAGCCCGCAATTGTGGCGCAGTCCACGAACGACGCGGACTGAAC
GGTAGTCGTGACTCGGCAGAATCGGCAGACCTGATCAAGGCAGCCTAAGCCccccgagctgcagctcgtgtcgGTGACGATCTTGATCCCGACGGTAGCA
TCGCCATCTGAGACGGTTTGGCTGCACGTCTGCTTCGTTGCTGTAGTTGGCGCCGGTGCAGTCGTAGCTGGTACGGTAGTAACAGGAGCAGCTGTGGTCG
GAGCTGGCGTGGTCGACGCTGGTGTCTGGGTCGTTGGTACCACCGAGCTTCCAATGGAGGCACAGTCGACGTACGCAGACGACTGAGCGGTTGTCGTCTT
CCGACAGAAACGGCACACGCTATCGATGCAGCCCAGGCCTCCCTGTGCGCAGGACACGTCTGTGGCGATACTGATGCCCACGGCCGCGTCGCCACCAGAC
ACGGTTGTTCCACACACGTTGGCGGCCGTAGCAACCGGGCAGGCGTTCAAGTGTGCCGCCTGCGTCGTGTCTTTCGCTCTGCAGAATCGGCAAATGGTGT
CGATACACCCCACGCCGCCACTAGCGCAAGTTTCGTCGGTTGATATGCCAATGCCAACCGCAACGTTGCCATCTGAAGCTGTCATGGCACAGACACTAGC
AGTTCCAGCCTCAATTGCCTCCTCCTTTCGCCCAGAGATCGATGCTCCACTCTCCAGTGCCTCGGCGGGTCCTGCATCGTCAGTGGTTAGGATCGGAACC
AAGCCTACACCCCCTGCAGAACCATCGAAAGAactcaaggtgctgctggcccacGAGCACAGCAAGAACTGCGAGGACTGAGGAGTCAACTCGCTTTGAC
AGAACCGGCAGTGGTCGTTGAAGCATCCAATGCCCCCGTAAAGACAAGAAGGATCTGTCATCCCTCCAACGccaactgcagcgtcgccactTGACACGGC
GCAGGTACCTGCCGAGACTGTCAGCGGCGCCATGGTAGGAAATGACGCTCCAAGCGTCTCACAGCTTTCCAAATGTGCCGACTTCAAGGTGTCAATAATT
TTGCAGTATCGGCAGCGGTCATTGTGGCAGCCGagcccaccagcagcacacgaaACATCGGTAACCACCTGAATGCCGAACGCCTTGTCTCCATCGGAAA
TCCCACAGCTCGTCAGCGATTCACCCGCAACCGATCCAACTTCTGAGCCAACGTCGCTCGACTGCGTTCGAGCTGTCGGAATGGCGCTACAAACAAAAGC
ACAAAGTGCTGCAACCTGCACGCACGAGCGCCATCTACCACCGGAAGAAAACACCATGGCGGCTTCAAATCAATCTGCGTCTACAGCCTTTctctcctct
ctctctttctATTCGAGCTGTGAAGAAGGCAACGCGTTCACGAATGATGCTGGTGTACGCACTACCTGAGATGCGAAGCAACCGTATGCGATCTAGTCTT
TTTCAACGATCGGTTGCATAATAGAGGAACTACCAAGGCCCCGTCCGCGTGGATGGTGGTGACATCTTGGTCAAATACCGTTGAGGAACAAGCTACGACC
ATTTCTTCATGCGAACATGCGCTGCTATCGATTGGGGCAAGAGTCGATCAACACCAAGGTCCGTCCGTTTCACGGGGATCGGCCTCTACCTACAAAAACT
ATTTTATTGCTATTGGGACGAAACGAGTGCCGTGCGATCAAGCAAGTATtgggagctgcagcaagtatCACAGTCCTCCTACTTCCCATGGAGGAAGTCT
ATCACGCAAACTTGCCTCCATTTTCGCGACTACCCACGATTGTCGAACTCGCAACTCGGAGTTGGAAGACGACACCTTCGGCTCTTACCGGTTTGTCCAA
ATAAGTGCATCATGTGAACAGGAGTGCTCACGGTAGTACCGAGTTGAACGATACTATCGGGGAATGAGCGCACACGTATCATACATATCCATACGTGTAG
GAGAAGAATGCCATAGCACCCATTCGTATTCTTGGAATAGCACGGCAAGTTACGCTGTTTACAGCTCAATAGTGTGTTAGCTTAAGACTACTTTTTTTAT
TCTCTCTCCCGACCGAGTGCATGGTTGCATGGTTGCACGCCATCAAAACATGAATGCTTGATAGGAAGGTGGGAGAAGTAGATAATTTCTTTCACGAACG
CTCGGAAGTTTGacttcaagttgaagacgTTATGTTGCTCGAAGAATGAGAAACTTATAGTGGACACACGATCCTCTCAGCTCCAACATCTTCGTGAGTC
CCACAGCTCAGTAGGAACACGTCCCGATGAATTGTCCAAGACAGGGAGACGGGCATCATCGAGCACCTGACAATTGACGCTTCCTCGTTGCTGCAATTGC
AGTACAGTAAAAAAGGAATACGCTGCCGGTGGTCACAAGCCTGTAAAGGGCTGCGCAGACAGCCAAGCATTTCAGTCCAGTCGATTGGAGTCGAAGGTCG
CGGTGAATCTGGTCGATGAGTACCGATAGGCTTGACACACGCCGGCACaagcgcttgagcgccatTCATTTTCGATTTGCAGAGTttgcgcagcgccttg
agaACGCTCCAGGAGGAAGCGCTTTCAATGCTGCAGGCAGAATGAATCTCGTTCAAGGCGCCCCAACGTTTTTGCGCAGCAATGAGTTGGCCGCCGTTGA
ATTACAGCCGCACACGGCGAATCTTGTCGAAATGGTCACCGTCCATCTTGATACTGAGGACTCAAGTGCCCATAATGCTCGTacagtgtacatgtagtgc
tCATTGTTCAAAATGTGCCGTACACTTTGTCATGCGGGCACTGtttgctacatgtattgacGGTCAGAGAGCATTGCCTCACGCGTAGGATTATATAATT
ATTTTTAGTCGTCCTCTTGACCCTGTAAGAATCCCTGCCGCCACACAATCGGGTACATGTATGAGGCTTATCATGTAAACTATCACAAGGTGTTGCACGA
ACAACATGGTATGCGGGGCTTCCGAGTAAGCGGGAGAACTACTGTACTGCGGCGACAACTGCGATGATGAAGGCAATTGACGACACTTCTTGTAGGCTTC
GGAGCATTCCAGTCCTACCGTAGGTGCCGCGAATCTGACTGGCACGTAGGGTAGACCTTGCTGGCACTAGCGCTGTCCACCATTCGTTATTATTATACTT
CAAGTAGTACGCAGCACTCTTGCAGGAACCTCCACGGGGATATGATGAATCTCATTCGAGCTGTCCAGCGCCATTAAAAGTCTGCggctcgcgctcctcg
tgAATCTTATCGTCGGAAATGTGATCTTCTCGACGCTGTCTACTTACAATTTTTTGTAGGCTGTCATATCGTCGTTGACATATTGCCACCACAGTCGACT
TCATCAGAAATCGCAGCCTGGCTCATTTTTAGGAGTGGAGGCATGATACAGTACGTGAAAGGCAACTTGTATTAATAAGTGTGTGCTGCATTTCAATCTC
ATGAAACACGGCACAGGTGTCGAACTGGCACGACAAGTCGCTGCCATGTGCCGTTACTTATTACTACAAGCACATGTACGTCGATTTCACGCTTGGGCAG
CGACTGTGGGGTGTAAACACGGGCGAGAGCGAGGGCACGAGCAAGAGAGCatggtggagcagctctcTTGATAATAACTCTTCTGGTAGAAACTGCTTGG
TTCTGGCTGTGGGAAAGGCCCGACAGCTATGGTACACTACCCAGCCACCGCAGCTCACTTTGCAGACCATGAGGCAAGCTGGCGGTCGGTGCTTTTGCGG
TCTGATCCGCTTGGAGGAAGGCGTGTTCAGCGCTTAGACTCGCCGGACGATGACGCCGAGCGCGTCGCCGGCTTGTCGGGCTCGGTCGAATCTTGAGCTG
CTTTTCCGGTTGTCGGTCGCCACCTGGATTCACTATTGCGCGCACGGCAGCGGAATCTCCGAATCTCGGCGACTGGATGGACCTTTTCTACTGTTGTTTC
AAACCCTCGGCCAATAGTCTCCAATTATCAGAGCCAGTGAGATGTTATGTATAAAAGACAGTTCTAGCGTGCGATGTTCACCTTGTTTTGTAACCTAATT
TCTCATCGCGTCTTGTTCTGCGTTCCCCTAATTTGTAAAATTCGTTCGTGAGCCTGTTCTTGAATCTCCAGAAATGGGCACGTTGAAGGCGGAAGATTGT
GTTGACTGACACCTGGTTACGGCCGCAATAGCTATCGCCCATTAGCGCTCGATGCAACAGGCCTTTCGGAATCCCCGCCAACACGACCACGCTCATCACT
TCCGAatcgccccccccccgtaGGACAGACCGCAGCCGCGTGTCGTCAATTCAGTCTAGATCTCGCCCATGAAGTTCGGCAAAGGCCTGCTACACGAGAT
CGTGCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAACTACAAAATTctcaagaagcgcatcaaGGCCGTGACCCGCGCGGCGCACCACGCCGCCAAC
CAGCGCGATATCTGTACGTGGAATTGTAGATACATTTCAGGTTCTGAGCAGCTGGGGGCGGGTACTAATGAGGCTTTTGCGTCCGACAGCCGAGTCAGAG
TTGGAGGTGGCCTTCTTCCGCGACCTGCAGGCCGAACTCAAGAAGATCTCGCTTTTCTACGCgggcgaggagaagcgctGCTCCTTCCGCTACCACCAGC
TGCGCTCCGTGCTCAAAAACCTCAAGGTTTGTAGAGAACGGCAGGACTCCTAGTGGACTCTTGTGGAGCGCACTCTCATCGACGTGTTGGTGCCTAAGCA
GAAACGGGAGAAGATCGAGGCGtccgaagcgcagcgactcaTGTTCGCCTTCGTGCACTTCTACCGCGAGTGCATCCGCCTCGAGAACTTCGCCGTCATG
AACTATCAGGGATTCTCCAAGGTGAGCCCCAGCTTCCATGTCGCTACCGTCACCACCCGTCTAATTCATTTTCGCTGCTGTGATCAGATCCTCAAAAAGC
ACGACAAGTTGACGGGGTACAACACGCGCTCCAAGTACATGCGTCGTAAGGTGAACctgtcgtcgttctcgagcTACCCGAGCCTGCTACAGATTTTGTC
CAGTACCGAGGACATGTTCcacgaggtggagcgcgaCATCCGCATGGCATCTGCCGTGTCCAACATGAAGCTCAACATTGAATCGCACGTGACGACCGAC
CCCAGCAGCGCCCGCGTGCTGGCTCCGGTGGTCCAAATTCCGGCGGGAAGTTCGCCCACGCCCGTGCACACGTCGTCGCTTCCGTCCAAAGTTCCCTCTC
CCCACCTCACGCCGTCCAACTCTTCGACGGCCCCTGCGCCGTTCCCGGCCTCGGTGCTGTGGACAACAGAAGACCTGGACGCGGCCTACAAGGAATCGAA
GCAGCCCTTCCAGCTCTAGCCGCCGACGCTAGTGCATCGTATCAACGTTTAATTTATCCGCAGCCGTACGAATGCGTTCGCCCCGTCAGGTGGTCACAGT
TTACTTAGAGTGCGCATCAAAACCAGTGGAGCATATTCAACATTTACATTTTAAGTTTTCGAATCTACAACATCAAGTTTCACCTTTGTATATCAATCGA
TTCAATTGGTCAAATAATCACTATAGCACTGGTCCCATATCATATCCGGCGGCATGGCTCAACTCCTCCGCGCTGCCGGTATGCGCCCCCTCCCCATGCC
TGTGATTCCGTCATACTAACCCTTTGGATTGTGCGCTATCCGACAGCGAATGGCAATCTCGAGAAGGTGATCGAGCTGCGCAGTGACTGGGGCTTCCAGA
ACAAGAAGGGCGAGTCCGGTACGAATATTGCCAAAGCCTCCGACAATTGTTGCTGCCTTGCGCCCCTTAATTATTGCGTTActgcttgcagtgctgcacg
tggcggtggccgaaGACcagctggagatcgtgcagcacctcgtgtCCAATGGGGCCATGCTCAacctgcaggagaagaaaCGCCGCTTCACGCCGCtgat
gctggcgttggctCATCAGCCGCcgagcttcgaggagctcttccaggcgctgctcaagggcaAACCCGACCTGAGTGTGCAGGACTCGTCGGGCCAGACG
GCGTTGCATCTGGCTGCAGGTGGGAAATATATCGTCCGAgaggggggggagggggcgTGGATACTGAACGTTGTACTGTGGTGCATCAgagtacgaggag
ctcgagtcggtaaagctgctgctgagagcCAAAGCCAAAGCAGACGCAGTCGACAACAAGAAGATGACGGCGCTCCATATCGCTGTCGGAAAGGGGAACC
TCGAGATAGTCCAGCTGCTGATTGAGACGGGTCGTGCCAACGTCAACGTGATGGACACCAAGGGCAACACGCCTTTGTAAGTAAGTTTTCTTTTTGTACT
GCAGAGTTGTGGTGCTAACATTTGGAGTTGATATCTACAGGCACTGGGCGTGTATCAAGAACGGCGACGACCAGCTTGAGCTGATCAACTATTTGATCTC
CAAGGTTCGTGCTGCAATTCCAAAAAGTCTGATCCACAGGATCTCACATTTAACGCAATTATTTTTTCTTGTGTAGGGTGCAAAACCTCTCAAGAATACC
CACGGAAACACACCTCTGCACTCGGAGGCAATGCACTGTGATCCTACTGTAACCTGGCCCAGCGCGGCTgcggaggcgctgggcaCTGCGTTCCCGGATT
TGATAGCCGAGGTCAACAGCAACGGTTTGACTGCCCAGGAAACTTTTGAACAGGACATCGACGCTGAAGAATCTGTTGAGATCTCACCAGTAAAGTCGTC
CAAGAAGGGCGGCCGTCGTGGCAAGGGTGGCGACGATGAACAATACCAGGATatcactgctgctgcccgtgccgGTACGTCTCAACACTTTTTGTCATTT
GGTTGAATTTCATCGATCTAATGCGGTGATGTAACTCTACACAGCCGCTATTGCTcactcgaagaagaaggttTCCAAGAGTAGCATGGAGGGCAGTGGC
ATGGCTCCGTACATGTGGGTTGCCTTGATTTGTGCAATTCTGGCTGTCTTGAATGCCATGTTTTCTTCGTAAGGCGTAGACTAGCAGGCATCCATTCTGA
GCATAGTTTCATTCCAATACTCAGACGTACCAACAGAAGGTGAAAGTTGGCCCTCTGTTTTGAATTCTAACGTGTTCTTAAGCTCTCAGTCACTAccaga
tgaagacgaggattcatcgtcgtcgtgatgctccttctcttcttcctcgtcttcttcgtcttcttcaccgaCATCAGCCTCATCTTCGATAAAATGATTT
CGGCCTTGGGGACGGCCAGTGATTTCAACCTCATCATCCGAATCCGTCTCACCCTCGTACGGATCCTCATCGTTTTCACTAttttcctcgtcctcgtctt
cagaCCTCTCCTCACCACTGTAATCACTATCCTCGTTAGCAAGGAAGCCCTTCAGATTGCcgttctcgtcgacgtcttcctGGTCCAAACGGCTCGGGAA
GTCCAGTCGTCCAGTAAGGTCAGGCAAGTCGAGAAGGATGTCATCCTGGTTGccgtccaggtcgtcgaAAACATTCGACAAgagcacctgctgcaccaag
GCAAGCTTacgctcgagctgccagtGCTCGCAGAGTTGTTTCAGCAGGCAACCAACGTCACGCACGGTTAACAAGCTCTCCAAAAGCGGATGCAGAAACT
CCATCACTTCAGCGTTCGACTCCATCAGCGCTACACGCCGCTCCAATGCCGAGACAAACGATGGATCGCGCACACTCAAATGCCCATTCTCCACAGCAGA
CGCCATTTTGTTCATCAACACTCCTGAGTTGCCCGAGCCGGCCTCAAAGACTTGCACAAGTTGCTTTGCGGACAAGTTCACACCCAATCCCTCCAGGAAA
TCAACACTTACCAGCTCTGGGCAGGTATCACGCAGGAATCGAGCAGTCTTGCCCTCCTTGAAGCGCCACTCTGCGGCAAATAGTCGAACTAGGCGACCAA
CCTCAACAAGCTCCCAGCGCTCTCGAGCAGCCGAATCGATGAGGCGCGCAAATAATGAGGAGTCGTCGCCATTACGGTGTTCAAAGTCAAACCCACAATC
AACCTCACTTTCTGACGAAGAGGACTCGTCAGTAAGGTTGACAACCTGGTGAGACACGGTCCTTTCAACACGTTTTGGAGCAACTATAGGCTGGCTTGGA
GTTTCTAGAGCTGGCAAGAACATGTCATTTTTCTTCTTTGCATCCTTGGCCAAGGAAGCCGCAATCGGTGTCAAGGGCTTGGTCGTCCTCTTTTCTTCGT
TGGAAAGAGCGTTTTTGGTAGGAACAGCAGCCTTCATAGCAGCTTTAGCACTGTTCACCTTCATGCCTTCCGTTTTATTCTCTGCTTCATCCGATATAAC
CAGTGGTGTTCCCTTCCTGGGCTGTGCAGATTTATGTGCCATCGGTGATGCACTCTTCATCGACTTCACCCCCGGGGATTTTTTACGCTTTTTGCGAGAT
CCTGACGATGTTGGTGACGGCGCAGTGGTTCTGATAGGTGCAGAGTCATTTGCGGTATTTCCTACAGTCGGATCCGCTTCCGTCTGGTTGATACTGTCGC
CACTCGTGGCGTCGTTGGCTGTACCCGCGCTTGTCTTGAGAGTATGAGACGCAGGCTTGCCGTCGTTTGCCTCCCGTAATCGCATCTTTCTTTGCTTGTT
CTTCACCTTTTTCTTTTGCCTTTTGGACAGATGTTCAGTCGAGGCGAAGACGTTGCTGTCCACCGCATCTTTCAACGCAtctttctcctcctccgcagGT
CCCGTCGCCTTGTCCGTTTTCGACACCACCCCACTCTTCCCAGCTTTGCCTTTCTTGTGCGGCTGCTTGGCAACCTTCTTCGTCACGATCTCCTTCACAC
TGCCaagcgcctgctccagcggGTCCACCCCGTCATCctcgtctccttcctccCCGTTCTGCATCGAATGCCACTGCGGAGCTTGCACCGCCGCCTTTCT
CACCTTCTTagcctgcttctccacatTCTTAGCCGCTTTCTTATCCTGTGGCTTGCTCTTAGCCAcagtcgtcgacgcccgcggaagcttcacgacggcc
ggacccgccacctccttctccgtcgtcttcacAGCCACAGCCGTTGCAGCTTTTGTCtttttctccttcttgggcttcgtCTTGTAAAATTTCACCAGTG
GCACGGGCTccccgtcgtcctcgtcggcggatttcttcttgcgcttcttgtgcttgggCTTGAACAGCACGCGGGGGGTCTCTGGAGCTGTCGCAGCCGC
CTCTCCCTGCGGCAACTCGAACATCCGCGCGTGGAAGGCTGCGAGCCTCTGgcgggcgtcgtcatcgccgtccTGCTCAGCCTGGAAGCTCTGGGCGCGC
CGGCGCTTCTTGGTCCCCATCCGTCTTTTCAAAAGTGAGCTCTTGGGCGCGAGGACCGTTACGGACCAGCAGCTTTTGCACCAATGACAACACGTATGAA
CTCATGAACCAACCAATCACATAACAGATGGACGATAAAAAGGCAACTTTAACAGCCAAGATGAGACCATTGACGGTGGCGGtcggcctcgtgctcgtcA
CGACGTGTTGGGCGCTGGGTCGTTATGGTCTGCAACACTGGAGTCAGCGTGAGAAAGCCACCAAGCAATATCGCCGCGAATTGACGCGCTCTAAGCGCCG
CAACCGCAAGGACGAGCGACTCAAAGCCAAGAAACTCGAGCGAAGCCGAGCGCTGGTGGTCGAACGGGCCGAAAtgacggagcagcagaggaATGAGCAA
CGTGAACGCATCCGCATGCAACGCGTGGAGCAATTCGTGCGTTCGCTAGCTAAAACGGAGGTTGATTTATACAGTTGTGGGACTGATTGGCCTGGTTCGT
GCAGCAAAAGCTGGCGGAAGCTCAGCTGAGTGGTGTTCGGGTCGTCGTGGACTTGGCCTTTGTAGCGGATCAGACGACCCGAGTATGTATTTTgtgtggt
gctgctggagaattATTGCTTACGACTTTGTTTTTGATTGTAAGGAGCGGCACAGCATTTTGAAGCAGCTCGGATGCGTTTATGGCTATCTGAAGACTTG
TCCGCTTGACAGACTACTGGCGCTGCACCTTGTGTCGTGTACACTAGAGCTTGCTCCAATCTGCGAGCAGCATGGCGCACTAAGCTGGAAGGTATGGCTG
TATCTTGCTGCTTTGACACACGGAGTACTACTCCTGCAGTTGATAGATAGTTGCGTCGTATCGCCCTTGGACAGATCGGAAGGCATGAAGAACCGCTTGA
ACAGATTTACGACGCTCATGAGCTCGTCTACCTCTCACCAGATTCGGAAACTGTGCTTGAACAACTCGATCCAGGCTGTGTGTATGTCGTCGGTGGCATC
GTCGATCGCTCCGTTCGCAAGGTTAGTGTGCCTACTGATTGATATCTTAGGGCAAGCTTTCGCCTAACAGAAATCTTGCTTTTCCATCAGGGTGAAACAA
AGACAAAGGCAGCTTCACGCGGCATTCGAACTGCGCGACTGCCACTTCAAGAACACTTCGAGCAGTCGGGAACACGCGTTCGAACTCACATCTTGAACCT
GGATTCTGTCATCATTGTCCTGAATGAAGTGGCGAACCACGGAGACTGGGGGCGTGCGTTTCAGAGAGCAATTCCTCCACGGATCTCTCGCAGTAAAGGA
CATAAGAGCAATGCAGACAGCAAGAccgctgcccaagaagaaactcAGTAAGTACGTGGGGACTTCTTGGGAATCGATGACATGTAAAACATGAATATGC
ACTTTCTTATCGACACGACTGCTGGCGGCTCACTCTCCAGTTATGGTGGCTATGCCAGCGATGACACTTGAgactgcggcagctgcagtggCCGTAgccg
tggcagcagcattggTCCAGTTGAttccttggccagctcgttgagctACCGTCGTGTTGTCCGCGTCGATAGATTGGCAGTGGGTGATCGCATACACGAG
CTTGTCGTGCATGACCTCTCTGCACGAGTAGGCTGGCAAGTCGATAGAAAAGAAACCTGCAAGGCACTCAAAAAGTGTCAAACCATGGTAAAAAACGGCA
GTGCCACAGACCACAGCAAACTTACAGGTATGGGCAATAGGCAGGTACATGTCGGCACGGCCTGCAGCCTTGGGCAGCCCTGAGATCTTGAAGTCCTGGG
TGAAATCCGCAGCATGCGTAGGCAAGCGCGATCGGCCCCTACAATTTATAAACGTAAGAAGAAACATGTTAGGCAAACTCGATGCCACAAAGTTTGGTTC
TGCCGCAGACTTACCAGACGAAGCGCAGGAATGACGACTTCTGTTCGTCACTGAACTCCGCCAGGACGTcccagaagaaggcgacgtGCGGGTCTGTTGC
CTGGCATCCGTCGCCGTATATGGTGCGTCGTCGCAGAAGAGTTATGTCAACCGAGGCCTTGCCACAGACGAGCGTCCGCAGTTCATGCCACGAGAAAAGT
CCAAGCGTAGGTGCCGGTAGGATGGTCGCCACCCCCCGAGATATGTCGCCACACACCGGCGCAAACTCAATTAGGCGAAAAGTCTCAACAGCGTACGCGT
ATTCCTCCCGATCGTCCCATGTAACGTGCAAGTGTCTTCCCCCTGGAACCAGCTCGACAGTTTCCCGCGAACTCGACAACACTGTGAAGCTTGCGTCCAC
AATCTCGTCGAACATCGTCTCCGTGATACCATGAGCGTCGAGGTTAGCGATCGTGTCCACAACCTGGAAACATCCTTGGTGAATAACTTCAATATCCTGT
CGCGTCACTTGTTGCCCAACTAGCAACTTCCACACAACCGGCGGAAGATTTAGGTCTAGTGGGGTTTTCGTCCGCACTGCCACACCCGCTAGTTTACCGA
GGAACTCGGCCATCTGGACTCGTCGTGGGTTTGTGCGCAGGTGCGAGTTTGTCACGAAAAGCTCCCGGTTTTCACCTGTACTCATCAGGGCGTTGGGGCA
TGGCCGCAACAAAGGCAGCATTGGCGTGAAGGTCTGCAGCTCTGAACTTAGTTGCGCTAAGCACTCGCGGTACAACCCACCGAAGTCATCACCAAACTCG
CCCACAAACTGGCATTTGAAGGCGCGGTCGGCGCCTCGTAGCAGTGTCGGTTGCAGcccatgaagctgctcgaatGTTTGTGCAAATACACTATCGCGCT
CACCCGCTTGACTAGCAAGTGAATCACCACGCTCAgaaagctcaagcgcgtcaTGAGCACGGTGACGGTCAACCTCAATTtccggacgagctgcagctgg
tgccTGCTGTTCTTTCAAAACGCCAAGCCACCACGCAAGCTTCACGTGCTGGAAGACCACGCCGCGAAGGGCACGTGCACCACGGGCAAGAAGTGAACGT
TCGTCGTGAGCCGAGAAGTCGATGAAAGCAAGTGATGTCTGCAACCGGCAGTTGAAGTTGCGCAACACCAAGAAGCGGCGTTGCAGCGCTTCTAGAGGAA
TGCCCCGTAGTGCCGAGAACGCGTGGATCTGTTCGACCGTTGGAACAAATTCCTCTGGGGTCATACGGAGAGGATCACAACTTAACAAGGCCTCGGCACG
GGACTCGCATATCTCGTtcacgagctgcacaagaGCGCGATCACGTGCTGGCGTAAATACGAGCTGTGACGCGTGCAGACGGCGTAACTTGGGACCGTAT
TTGGTCGCCAATAGGCGGCGCCCAGTAACTGAGAATTCTGGCACGGCTGTGAATGCTACACCCCACTTGGTATCTCCAGTcgactgttgctgctggtgtt
gaagCAGTGTCGGTACGTCACCTGTTGTTGTCACCTCTTCTGCGGATCGAACAGCGTCGGCGTCTCCATCGATGGGTGGTGGGGGCGGTATGGCAGTCGT
ATCTAATACATCGTCGTCTAAGTTTTCAGACAGCGCTAAGGCCTGCTCATGAAGTAGCTGGCGGTGCCGTGCGCGGCGCGCTACCGCCTCAGCCTCTTCA
CGAATAAGCGCTTCCATCGCGTGCATATTGGCAAGAATAAAATCGGCAGCCTGCTCAGCATCATCTTCACAGTGCCGCAGAGCGTAAACGCACCATTCCA
TAGGGAACCCCATTTGACTCAATGCGATAGCCAATTCCATACGGAAGTTCGGGATAGAGTCGTCACCGAggcctccttcaccagcaaCAAACCCTCcgag
atcttcttcttcttcgctgtaGTATGAATCCTCTCCACTCGCCAGTCCGCTGCCAGTTCGAAGTAGCCCTGGCTCCAGTCCTCCATCCTCGACACGGTGC
CCGCCGATAAGATCAATTGAATCGCGTTGGTTGTACAATGAAAAACCAGGGTAGAACGTGCCCTCGAGTTTGGGCCCTGTTCCACCAGGACCAAACGCGA
CGCCTAGATCCTTTCCATTGAGCGCATAACTCAGTGTACCGCGCCGCAGGTCCAGAGTGAGGCGGATAACGTCTCCAGTTTTAAACTTGTCGCCATAAGT
GCCACGTTGTTTGCTGCCATTGTGCCAGAGTGCACGATTGCCTATCCAGCCCCAGCCACGGTTGTCCTTGCCTAAGTAGGAGTCTAAGCGAACGTCTCGG
CGAGCGATACCCAAAAAGATGTTCGAGCTTGCAGTCACGAAAGAAATGCGTACCTCCCAGATGTGCACTCCTCCATCAAAACGTGCCACACCGATAGCTG
ATTGCCAGCCCTTATCGCGCGAGAGTGACAGCCGGGTATCTCTAGCTTCAAGTTTAAGATACGGACCCTTGCGTACGCGATCGACGCGGCATTGGAAGTT
TGATTGCACAGGGAACCGCCACACAAAGCTGTCACCATCAATGGTTACCTCCTGTCCCCCGCAAGCTCCCGTAAACGCTCGCACTTCGgcttcacctcct
ccatTTGTCGCGCCATCGGCCCCACCTTCGTTACCCGCAGTACTTCCGCCTTGCAGAATCTGCAGGCAGTGAGAACTGGCTGTCTCACTTTGAGGATCCA
ACCGTACACGAATACTCGTAGCTAGCGGAATATTAACAAGCGACTCTTGCAACTCGAGATCATACGGGTGCGCGCTCTCCACACGAATGCATACGTCTTC
CGAGATATCCGACAAGAAATTGTCAGCTGAAAGCATGAACTCATCAGGCAACTGAGCTACAACAGCAGTGTCACTCGATTCTTCGGTTGGCTCGTCACGA
GCGTTCACCTCTTCGGGTCTAGCTGGATCCATGAGAGCCTTCATCACGCCGTAAACCTGACTTAGTGGTTCGAACCACTCGAAGGCACTCATCAAGTTGT
CACAGTCTAGCGAGTGGAACCTAAAGCTGAAGTTGGCCTGTTTGGCGGGCGTTGTCGCTGTAGCTCCCAGGTTGGCGAGCAATTTGCAGTCTGCATTAAA
AGAAATGGtcggatggagctgctgagggCCTGAAATGCTCGAGAAAGCGGTGCCAAGCAACTGTCCGTTCTTGCAAAAGAAAATTTCTTGCGTGTCGAGG
CGCGACCCACAGCCAAACACGTCGCCAGGACTGACAGCACCAGCGGGCTCAACCCATCGCCAGCGATCCAAAAGAGTATCACCGGCACACAGTACTTGGC
CGTTTACAGGCGCGAACGAGTAAGATCGTGAATCGTCTGCGCTCCCGCCCACTTGCACTCCTTCTAGCGGGAATGACGAAGGCGAAAAGCCCAGCGCGAC
TGATCCTCCCATGCTTGTGCTAGAGTCCCACTCCACGACGGTGACTTCGAAATACACGATTTCAGCCTTCACATCGTCTCCCATTGTCATCACAAGAGCT
GGCGTGTGCTCAAAACGGCAAGAATACACTTCCCCAGGTGGTACACCAAGTCCCTCAGCTGCCAACGcttctcgtgctgcagcattaCTGCCATCTTCAG
CCCGATAGTCTAGCAAGAACTTGCGCTCTTCTCCTGACAGATGCCGCGTGACTGCCATCTTTGACGAGTGACTAACCAACATTTCCACGAAAGGCTCCTT
GGAAAAGTGGAATCGATATGGCAGGCTCAGTGAGCTACCACCATCGCGTGCTAAGCTCGCAGCCAACTCTTGCACCCGTTGGCCGCGTTGTTGATCCTCT
ACAGCTAGCATCAACTCCACGAAAGCTTGTAACAGAGCGTGCAGCGTAAATCCTccatcttggtcttggcTAAGGGCCATGATCTTAGAGCGACAGTAAA
GAAGGGATTGTTTGTCATACCAGTGAGCACCTCGCTGAACCACCGTAATAAGTGCTCGCACAAGTGAtacagcagcttgtccactTGACGGTTGATTCTC
ACGCAATACTTGCTGTACTAGCGCAAATAGAGCAGCCGGCAGTTCAGGACGCAACTGCGTCGAGGTAGTTTGCTTCTCTTCCTGCTTGCTAGACAGCAAC
CGCTCGTACTGAAGCAAGACCTCGAGGAAAGCAAGGACGTTGTCCACACTAACTGAAGCACACAAAACTAGGTCATCGTCCGAGAGGTTCAGAGCAAACG
CTGTGCTGGGCTCGCTAGCACTGGCATCAGTCAGTGTGACCACGGGAAGAAGCAAGCCACTGCTGAAGTCTGAGTCCATTGCCCAAAGCGATGTCTGCAC
GACTACATCATCGGCaacaggcagcagcagctgcattCGGGACGCGTCAGTGGACTGGTTCTTGGCGCTCCTTAAGGTCTGGCCTGAGTTATCGTTCTCT
CCGCCCGtgtgttcttcttcgtgatcTTCATTCTCAATCTCCACTGCGGTGGGAAGCTCCACACCTCCTCCACCAGTAGATGCGGgagatgctgcgcgcc
acACGCAATGGAAATCTTCAACGTGATTCACGAGGTCTTCGCGTACGCAGCGTGTGCACGAGACATCAGGAGGTTCAAAAGGGTCTTCTTTGCTTCCAGC
TATGCAGCCTAACGCCACGTATCCAGACGGCGCAACTGGCCACCAAATTGAGCGAAGTTGTTTGCGCTGGAAATCTGGGTCACTTTCAGAATTTCTAGGC
AATCCCTTTCCAGTAATGTCCACTCGCTCAAAACTGACAGGAGGCACTAAAAGTCCTTCGTTGCCACTGTCGCTGACGAGAAGCATCGGGGCATCTGGAG
CACCGTTACCGCATTTTACAACGTCGCCGAGGCAGAACCATTTACAACCTGGTGTCGTCGATGTGAGACCTGGTGGTACCGTCGGACGCCAAATTGTCAC
GGCATAGTCTGCTGCTGACTTCATCCACACGTTATCATTAACCATTGCAGTGGAAAACCGCTTTCGCCATTTGTGACGGTGCTTCAGTAGCGGATCCGAT
GGTGGGATACTCCACAGGCGCTCATACGTGTCAACCACAACAACATCCAGACCGGATGAAAGCTCCATGGGCCCCTTGGGGAAACACCCATCCGACTTGC
GTGCTCGAAGGGGTGAGGTCTCCCAGCTCAGGGTCGCGACAGGAGCCGCGTGGGTGCGCGAAATAATGTGCAGGATAGTCTCGAATGTCACATTATCCAA
TGTGTTTGGTTGGTCCTGATCATTgacgtcttctccagcgctgACCCCACTGTTTTGCTCGCTCTCGGCGAGACATTCGATGAGCCTCGTGATACCAGCC
CAGCCTACCTTTGTTGGCTGCTCTGCCACTTGGTCAATTGATCTCTGGAGAATCGATAAATTCTGGGACGAGCATAGATTTTCGGCCAAAGTCTGCGTAG
GGGAGCGTGTCATCACTTCATGGACCATTCGAGTCAGAATTTGTTGAATCTTGCCGCTCTTTTGAGCCTTTGGTTGTTGATGCAGCTGGTACTCCAACTG
ACACGATGAGTTTCCGTTAGCTTGCTCGGGTGCGTTCAGAAGTGATATCAATGGCCGAAGAACCAGAGGGTTAGCTAGTTCACTGAGCGGTGCGTCCCCG
TTTTGCGACGCGCTTTCGAAAAGCCTCACAATTTGAAGAAGAATCTTCCGGGCATGAATGGCTGCAAGACGCTCACAAAGTACTTCCTCCTCGAGTTCGA
TCCCAAAAGCATTCATCTGCCGGACATTGTCGTCAAAGCTGCTGTTACACTCGCTCCATAGCGTCAGATCGGACTTTGGCTCCAGGTTCGTATTGCCCGA
ATGTTCCATCTTCTTCATTTTAACAGGACTGCCATTCCCTCTGGCTGCAAGTCGCTGAGGTACAGGAGGGAATAACGCGCTGGACTCTGTCAGGGCATAA
CTTGGATTTTCGTCACCGATGTCTTGAAAGTTAACCAGCGGTTCACTGGACTGTACATTTTCCCCAGAAGCCAAGGTGGCATCCCTTGATGCGCTGGAAT
CTAGATGTCTGGGTATCAACGCCACATTTTCCAGCTCGTCACCTCTGtctgacagcagcaaccgcacTGCGTTGCCGAAATTATTATTTGTCTGACGCAG
AGCTTCTGCACACACCGGCTCGGTTCTTCCGAGGACCATTGCCAAGTGACGGATATTCGAGGGATAGTTGCGCTGCGAAACATTAGAAAGCCGTACCAGT
TAGCGTTAGATGCCATCATTAATGTAATGAGAAACGCCTTCGATGTGAGTAACAATATGTGATCACTTACCGCGTCTGATCCGCGACTGCGTTGGATCAC
GATGAATGCCTCATCCATATTACCGGTCGTTATCTGAAGTGCTTCCTCGCACTCAGTGGCACTGACAACTAGATTTGCTTCTTGAACTCGAGCAAGCAGG
CGTAATGTAAGTACTTGCATCTCCTGAAGATTTGACGGCACATTCTGTACAATGTTTTGTTTTCAACGAAAAGCAACCACGTAAGAACTTCCAAGTAGAA
ACATAGTTAGACACACCAAAAAGCAAACGTACCGAACGCGAGACCAAGCCGGTATCACCACGTAGAACTCGTGTTTTAGCAAGTTCGTGTGGGATACTAG
ATCGCTGTGAAGACGACTCGCGATTTACACTGTCGCGGCCTAGTGCAATGCGAAGCATTGACCCAACACCGCCTTCCTGAGATCGAGGTGATGCGATCCC
TGTAGATTCGTTCGTTGCAAAGCTTTCTCGCTGTTGATATGACGCAGGAGAAAGGATGGCAGACTGTACCATGGTGGAATACATGCTTGCAGTGGGTGGT
CTCGCTGCAGGAGTCCCTGGGGCTTGAAGCAAAGAGGACCGAGGAGAGGTATATCCGCCAGCTCGGGGGGAATCTACAGCAGGATTCGGCGATAGCAGTG
CTCGAGGCACATCGCTTTCTGCGACAGACGTAATTACACGCAAGCCTTGCGTTACAGTCTGACGGTTGCTCTCCAACGAGGCAGAGCTTCCGCGGGTGCC
GCGGTTCTGTAACTCCGCTGGGCTTCTTGGTACGATCTGGGGAGTACCAATCTGTGGTTGCTGGTACTCCTGGCCGGGGATCAAAATGTTCAGATCACCT
GGGTTCTGCGGCGCTGTGACAATAGGGGGTGGCGCGTGACGACCTCCAATACTACTGCCCGGTGCTCGAACCTGGAATTCATAGGTGACCAGGCCTCCCC
GGGACAATATGAGCGAAATTCTAGACCCTGTCGTGATTCTAGTGCTAGATCCATGGATTCTCACACCATTCACGATAGTACCGTTCTTGCTGAAATCCTG
AAGTTCGAACTGTTCTTCGCCTCCCTCCGTTTCCCGCCGCAATCGGCGCAAATGGAAGTGGCGACCACTGACACTTCTATCGTTAACAATGAGATCGCAT
GCATCTGCGGCGCGGCCAACCCGAATGATAGGCGCCGTGAGAGGGAACGGAGTGTACTCGATGGCTGAGTGCCCCGCAGCACCAGCCGCAAGTCCGTGCT
CATTCTCATTTAGTGGTGGAAGGGGTAACAAAACACCCCAAGCACCAAACGGCAAGTCTCCTTCATTAGATCGGTCAGGTTGATGTCCAGCTCCGCGTAG
CCCATTTGCGCCAAAGCCCAACGAAGGATGGTTCACCTTACGACGAGGCGACTGTATAGCATCCATTCCCCAACTTAGCGCATTTTCACTTCCCAGCTTT
TGAACAACCTCGTCACGCATTTTGTCTTCGTAATGATCCAGTGCTGAGTCGACCACTTCCTCTGTATCCAAGAAAATTTGCCGCTGCTTTACACAAAGCC
AACGCTTCTGAAGAGCATTTGCAGTTTCAAGGCCAGATACCTCGGATTTTCTCGCCCACGATAGTGAATTTTCtgacgccagcagcgtggtcAGGCTTGA
TACCAGTTGAGATTCCATGCTCAAGAGCGCTGGGCTGAGGGCTGGGGTCTGTTTCAATAACGAAGATAATGCTTTCGTTGACCTCCACCGTATTTGCTGC
TTGTACATTTTAAGTCGGTTCCGCAGTACCTCGTGGACGGCACTGTTTTGAGGCAGTTCAAGGTCACAATGCATGGCACACTCCTCGTCAATAGAGGAAA
CGGCAGAAATCATCGATGATAGTATCACGATGATGTTTTCAATATCATCAAACATGTCAACAAGTGCCGGAATACGCTCCACAGCCTGAAGCTTTGAGAG
TGCAAAAGTCTGTGCTCGTGCATCCGCTTCGATCAACGGTGAAACGGGCGCTTCAGTACTTGACTCCACCACTACCTGGGCCAACAAATCAGCTGTGCGT
GGATCCCTCATTACCCCAGAAAGAACACCCAATGTACTTGAACACTGAGAGCCACCGTCTTCAACCGTCACGTATCCACCTTCCCTGAAGCCTTCGACAT
GGCCACCAACGATACTTACTGCTGCTACAACTGTTGACAATCCGTCCAGCGCATCCTTTGCCTTTTGCCAAAGCATTAACGAGTTTTTATCTCGAGTGGT
AGATTTCATGCCGTCAACCTGGGTCTTGCCATCCGATGTGTTGTTGATCGACTCGTCCGTTTCTGGCGATGAATTAGTAGACTCGGGTTTTCTCAGCGCA
GAAGCATCATTGGCTTCGTTCAGGCCATCGGCCAACTCCGTTTGCAAGGCCACACCATCGCACTGCTGCACATTAGTGTAGTATGCGCAAATCGTATCCA
GCATCTCTCCGACCTTGCTCGACTTGGCAAAACCTCGGTTAATCGCGGCATTGATCGCTACTTTCCATGTAGGATAGAATGTGAGATACCGTAGTAGTGC
CACAACTTCGGCTGCCTTGGCCTCTGCAATATGCGCCTTCTCAAGTACAACTTGTTGAATGTGGGCGATTCCTGTGTCCTTTGTCGTTGATACCCCCTTT
TGACAGTTTGCTGACTGGCACAAAGCAGTACTAGAGCACTCCAAGCCTAGCTCATGCGAGCAAAGACGCGGTCGTAAGAGAAGTGGGAGCCCCACCAGCG
TCATCAGCATGTTGAGTATATCTCCAGAGAGAACTGGAGCTGACTGTTGAGATCGGTGGATCTTGTTGAGCGCAGACACGGAGTGCTGCGGGAACACCAG
CATTGCTAGTCGAATGCACACAGTTGCCGATGCTAAGTCCGAAGAGCTCATTCCACTGATAATGTGAGCCGTAACCACTGCGTTCGAAGCAATGATAGAG
CCAACGTTTGTGTTGGCAGAGCCGCAAACGAGGAGGACACTAAGAATTTGATTCCTGTAGAAGTGGCCATGGAGAGTGTCCAAAGACATTCCTCCTATTG
TCCCAGACGGTAGTGAAGGTACAGCGATCTTGACACCAAAGTACTGCAGCAGACCAACACAGACACGCTTCAAGGGTACGCTGGTACTCAATTCGTGGGA
TGCTGCCGCATTCATTAGCGCGTTTGCGGTGCCATTTACAGCATCACCTGGCAGCAATTTCAAGTTTTCCAGTAAAAAGCTGATAAACGTAGACAGCACT
GGATTCACGCGCCCATTCACAGACCGCGAACGATTTTTGGTTTTGTCGTTGGCATCTTGAAGAGATCGATACATCAGGGCGCGGGCCATTGcccatccag
cagcatgcaACTTCACCAATGGTAACTTACGCTGTGGGTACCCTCGCTTGATCTGGAGCAGCGCTCGCTTCGTCACAGTCGTATCTGTGACATACTTGGC
GTCTATCTCCTTCATCAACGACTCGAAAAGTGCATCTGAGTTCACCAGGCAGCTATTTTCTGGGAGGTCTTTTGCTTGACTCGCGTCGTCAGGTGCGCCG
TCGAGTCCACAACTATCTCCTGAGCGGCCGGTAAGAATGTAGGAGCTGTAGAACCCAGCAGCTATATGAACCACTTCATCGTTTGCCAGTGAGTTTGAAG
CTACCGGCAGTGGCAGATCTGCAGACGGAAGTGTCCTTGAGCCAGCCCCAAGCTGCCCCTTGTTGTTGCGCCCGAATACCATTACCCGTCCATTCGACAT
GAGAATGAGTGAGTGATAGCAGCCACATGAAGCATCCTTGATCTTTGACGACAAAGGCAATGGAACGAACTGCGCACTATTCTTATGGTCTTTGCTTCCA
ATTCCCAGCTGTCCGTAGTCATTCCGTCCCCATGTGACAAGCTTGCCTTTCTCGCTGATAGTCACTGTATGATAATAACCACAACTGACGGCTACAATTT
TCTCGTCGCTCTCCCCGAGTGATGTCTTTACCAGAGTTGGAACTTTCATATTGCGAGCATGGCCTAGACCCAGCTGTCCATAGTCGTTCTTGCCGAATGA
GTACACCTCACCGCCACTAGTAGTTACGATAGTATGATACAATCCGCATCCAACTTTAGTGATAACTTGGCTCGATAATGACTCGACTAATTGTGGGGTG
TGCTGATGTTGGGTGTGGTCAAGACCCAGTTGGCCGCAGTCATTCATGCCAAAcatgagcagctcgccgttgcTTGATACTACCGCGCTGTGGTGATAGC
tcaccgctgctgctgtgatgTGATACTTTTCTCTAAGGCTATCAACCATGCGTGGCGTATGACTCTTCGAAATCGTCGACCCAAGTCCAAGCTGACCACG
GTCGTTATATCCCCAAGAGTATACAGCACCATCAGAAGCAACAGCTAACATGTGCTCGCATCCATTTGCCGCAGCAACCAAATTAATGGGGATTCCGCTT
AGCGCACGTACAGGAGTGGCGATAATAACCCGCTCCTCAAAAGTACCATTGCCACACTGCCCACTTTTGTTGAGGCCGCACGTGAATACTGCACCGTCCT
TCATTACTACAGCGAGGACTTCATTACCTCCAGAAATATCACGAATGGCCTTCGCAGAGAAAAATGGCACATGTTCCAATTTGCTTGTTGAGTTGCAGTG
TCCCAAGCATAGTTCTCCATAGTTGTTTTGCCCACAAGAAAACAACTCGCAATCTTCAAAACTAATCAGACTGGGCAGTCTTTCTGATCTGCCGCTTTGT
CCTGCTGTGATGGATCCTGTGTTTCCATCTTCAGCTGCATTGGGTGCTTTAGTTCTGTTTAAGACATCAGTTAGCGCTACAATCTTATCGTTCCACGACC
TTCGTGGAGGACAAAGCAGCGTGTTCGCATCCATTTGGTCGTCTTGAGTTTCACTGGAAGTGTAGACATAGTAGGCAGAGTCTATCTCTCCTCGGTTGTC
ATCGTAGCATGCGGCACACAGCTTAATACTGTCATCATCTCGCTGTCCGTAGTGTACACCAGATAACGGCATCCTCTTGCATTCCTCACAGCTGTAAGAT
CCTGTTGTGACCTCGTTGTACGCAGGTCCATTGTCGCGATCGAAAATGCCGCATAATCCAATGTATCCGATGTCGATGTTTGCGCCTGCCGACGGGCAAA
TTGCTTTTACAAGAATATACCGACCAGTAACTGGATAGGCAAGCTGCTTAGAAATCTGAGCGCAGCTGCCGTCCAGTACAAAGAATGCGACGGGTACGCT
TTCGTCGCGAGGGCAGCATCCATTACTTGGAGGAAACGGCAAATTAGCAAATTCTTCCGCGGTCATGTTGTCGAATTCTTGATAATATGCGAGATCAGGA
GGAGTACTGGTGATAAATACGATGGCAGCACGAAGAGGGCTGGAGTAGCCTGCTCCTGGACCTCGGATACTGATGTAGCTTACGCACATAGGAGTATCAA
CTTCATGCTTCAGCACCAGGTTCACGTTTGCCCCCTTTGCCGAGCTATACACTGTCGTATCATCCAGAAGGCAATTGCTGGCAGCATGCGAACTGCTGAA
CTCTCCTCCATCACATGAATAaacttgaagctgcaggctctTTCCTAGTTGCAGTTCGTTCGACGAAGACATGTGTTGGTTCAGGAGTTTTGTTGCGGGG
TAGAATACGTGTGAAGGTAATTCGACACGAGGTCGGGGGTGAAAGCACACGTCAAAGACTGTACCATTGCAGAGTGCTGACACTGCTGGAAAAAGGGGTT
TGCTCAGCGTTGATGGGTTGAATTGGCATACCTCCGGCTCCGAGCGATCCGAGTACAATGTTACGGTGGCTTTTTCGAAATCAAACAAAACTCCAAAAAT
TCCCCGCTCCAACACGTCATCAGCACTTTTCCAGTTAACATCCAGTTTATGCTTCAGCGGCACGTCTAACTCCGAGAAGTCATTGCCAACAATACCAAAG
CCGAGTGCTGACCGTCCGTCTTTTCCGGGCGCTACAACACGGATCTCCACGAAAATGCTTTCATTTTCGAAGCCCTGGCTCCCAACAATTGTCTCGAATT
GATCTTCAGACGAACTGCAGTCGCCGGCAGATACAGTCGTTCCGTTTGGCAGGAGTTGTAAGCGACTCCCCTTGAGCTTTCCATTCCAACTAATCGTAGC
TCCGTCAAAAGGAGCGGCGACAAGCCCCCCAGAGACGACAGCGTTTGGGAACTGAAAGTTAGAACTAGCATACCATAGCTTGGACGGGACAGTGGCCGCG
AGATTCCAATGCACGTCTGCGTCCTGAACACCGATCGAAGGAAAGTAACCACATCCAACTGAATCATCTGAGGTTAGCGTGGCCACGTAACACCTCTTTG
CTCCCTTGTAAAACTCCACTTGTCGCTCTTCACAATTCAAGAGAACCCCAAGAACGTCTGTACGATCCCAGCGAATGCCGGTTGCTCCAAGCATGTCCCC
GCTACATCCTTcgcggtggagaagcacgccACAGAGACTGCCGTCGCCTGGGATATACGTATTAAGATCCGCTGTGCCAGGGGTGACGCCAACAAATACA
GGGGTATCGCCCATCGTACGAATTGACACCTCCCAATACCACCGGCCTCTGTAAAAGGTTTTGTCAAACACCGCGAGACCGCCATGGTCCGGGAATTTTC
TCAAGTGTCGCTCACTTTCATCCCTTCCATCAAAGCTCTTGTGGGCGATCGTAAGCTTACGGAGATCGGTACCGAGCGTGATATAACGCGCGCAGATTAT
GTTTGGGTACTTTGCTCCGGTGGCAGCAGGAAGTATGACATACTTTTCGGTGCTGTTAACATCGGCTGGTGAGTTGTCTGACGCATTGTACTGAATGAAA
CTCTGCCATCCTCTCCAACTCGTCAAATCGGTTAGCAGCGATACCAAATTGGTACGCTGAAGGTCGTCCCAGTCGTGGCCTCTGTAGGGAAAGCAGCAAG
TCTCCAACACAAGTAGCACATCTTGCACAGCAACCTGAATAAAGGTTGATGATGTCTTCACATCACTTGATCCACAACCCGCTCCAGTTtcaatgagctg
ctgcatttgatGGAGGTGGTCTGTGGACGATTCAAGAAGAATAGTCAGCAAGTGGAAAAATTCTCGTCCAATGTCATTGGACAGCTGAGGCCCAGCAAAT
TCTAAATCAACGAGATAGTGCACTTTGATGGTGGAAGTTTGTTCTGATGGCAGTTTTCCCATGTTGTGGCCATGAGTCATTTGGACACGCTTAAAAGCAG
ACGACAGCATGGGGATAACGTGGAACCGCGAGCTGGGAATGTTTTCAATGCACTGGAGCAAACGAGCAAACGTCTTGAGCCCTTGCAGACGCATTTTCGC
GCGCTTCTGGTGTGCAAGCAAGATGTCTCGCATTTGATCTTCGGGGTGACGAGACCGCACTTCATCCTCTCGACTGGAGGTAACCAGATTACTGCTTGAC
TGCTGAATAAACGAGAAAATGTCCGCATGTATCtgttcatcttcttcttccatcACTTCAACAGACTTCGTTTCCATCAGCTTATTTAACTGACGGGTAA
AGCGCTTTTGCTCGGGCGCGGTTTCAGCTGGTTTGCTCTGAGAGACTTTCCCAAAATCTGTCGTTTAAGTAGCGAGTACACATTAGCTGCATAAGGCTGA
TCAGAGCAATATTGATATCTTACCGTAAGCAGTTGCAATAGAGATCCCTGGAAGAAGTTTCAAGGGAGAAGATGCCAATAGGGCAGATTGTATCGGTGCA
GGTGCtagctgaagaagaagaagtgctCTGCGAATAATTGGCTCGCACACAGCGTTATATAGTGCCTGTTGCCGTTCCTTTGCCTCCATATCAGGGGAAA
AGCCGCTCGGGGCCCCTGCCTCACTGCAATACCACCATTGATAACtcagaaaaaaaaactggaGAAAATCGCAGAGCTCATGTCCACCTTACCTgaaagc
tgcagccagcTTTTGCTGTTCTCGCACGATCCTAAGTGCAACACAATACAGGTATGTTAGAATCACTTCAGAATGCGATAAAGTGCACAAGGTCATTTAC
CAACGGCGCAACTGGAGCGCAGCCTTCCAGGCGTCAACCACCGTTTCTGCTAGTGCCCCTTCGTTGGAAATAGGTTCTGTCGTGTAGGAGATATTGGTAT
GTTTTAACAGAGCAGCAAAAGTTGCACGGACCGCGCGGTCCACTGCCTCAATACCACCACTCTTTTCTAATGTCGCCTCCACACTGTCTTGCCTCTTCAG
CCTCACAACACGAAGCTGTGGATTTAAGCTCCGTGGGGCTGATCCAGGATCCAGAGCATTACGCACTTTATCCAGGAGTTTTTTTCCGTAACCCACGTTG
TCCACCACTTGTAGTAGGAGGGCTTCATTTCGACCCACATCATTATTATCTGACGTAGTAACCGGGGAAATTTCTTCCAACCCACCTCGGAATAGAGGAG
AATGCAACCATCTCTCGCTGATAGCGGCTCCACTATCCAACTCACCACCAACAATTAAAGTGGCAGCGTAGTGACTTCCAACCCAGGCTACCACTTTTTG
GAGGTCTTTCAGCCACTCGTGGCTTTCTTCAATGGTTTTGTCAGAACACCGTGCAATGGGAAGACAAGTCTTCACGGATGACTGTGGAACTGGGGGCGGT
CCCGCATTAGCCTCAACTCCCCCTGGGGAAGGTAGTGGGCCCTCACTTACAGGATATATATGTTGCGAGAGAGTAGTCCAGCTGGGTATGAAAGAGATTT
TCCTTGGTTCGTATT