Description :
From Genome Similarity Track
Location :
Scaffold_738:2217- 3274
Transcript NameFunction/comments
Phypl_g10660conserved hypothetical protein

Sequence
1057 bases(100 bases per row)
AACGCATGGACATGACACCACAACTGCATCATTCTCATTTTTAAGCCCGTAgagcaacgtgctgctgctccagtcgcGCTCGGGGGAGCATTTCCACGCG
GGAATATCGCGTAGAACGCCAATGTCTCGCGATTTGCTGGCTCCGCCAGCGTTTACGtgcacgacgagatgcagcagcgctttactccttctgctcgagc
ttgtgAGTACTGCTGCGCTCTTCGCACTGTACGCGTTAGCTTCTCTTCATCGGACGACCCTGCTTCTGAACTGCCTTGTTGGAATCGCGAGTATTCTTTC
TGGAATTCTGGTGAGTCCTCACGTTTACTAcaacatttttttttcacgaACAGCACTAACCATTCGTGGTAGGGAGTATGCAGATCGACTCCAGCGGTTG
TTGCCAGCTTTATGGTTGCCACCGGATCGTGCTTTGGCTTTGCAGTGCTCGGAGGCTTGTGCATTTTGTTCACCTCAGATGTTGAGCTAGAGGTCGCAGC
ATTTCTCGACAAGTCACGagtgctgcgcgacgtcgagAATCGAGAAAAGGTTGGCCTTTGTCACTTCCGTGCATTGCGTAATGAACGGTTTAGCTAAGTT
TTGTTAATTTCGCTTgctgagcagcttctgggcGACACCAAGAAAATTCTGCagtttgctgctggcgtccttATCGTGAATGCTGTCGCTCACCTGTGCT
TTAGTTTGTACCTACGCCGGTTGGTGGGTgaacgacgtgctgcagtaGCCTTTTTGCAGGTACGTTGCTTGGTTATTCTCTCGTCGCGAAGACTCGCTGG
AGCTTACGTGAAACTCAAATGTGCAGGTTTTCAGCGTGGTCATGTTCCCGTTGTCTCTCTTTCTCATTCTCGGTGGCAACTACGTCGTCGACACCGGAAC
TCTCGTTTCAGCACCGTACGCTGGACTTGCGATTTTTGTTTGCGgggtcctgctgctgatggtggCTCTCCTTGCATTTGTTGGTGGCAACTTCGAGTAT
CGTCGTCTACTTTCGATTTGCTACTTGCTATCGGCGCTTATTGGGTCGTGCTCTATC