Description :
From Genome Similarity Track
Location :
Scaffold_108:22168- 24855
Sequence
2687 bases(100 bases per row)
TTACCTCCCGATAGAGGTGTACGTCATGAAGTTGACCTAGTTCCAGTAACTAAATACTGCGTAACACGGCAGTGGCATTTACCTAAGGAACAGTGTGACG
TCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTCTGTGTCAAAAAGCCTAGTGG
TAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATTCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAGTATGGTG
GTATGTACATTGTACAGTGCGCTCGACTTTGTCGACGGTTATTATCAGCTGCTCATGCGAGCAAGCGATATTCCGCTGACAGCGGTTAGTACCCCGAGCG
GTATGCTCTGGGACTGGCTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCTACTTTTAATCGTTTGGTGACGCAACTATTCAGACCTCACCGAGGCTA
TGCACAAACGTACTTTGATGAAATCTTTGTGCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAG
TGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTTCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCATC
GAGCGGACCCCGCCAAGATAAGAGCTATAGTCGATTGGCCGGTTCCAAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAG
TACAGTGAGAATTATGCAGATATGGCTCGTCCAGTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTGACACCGAACATGAGGCTTTCCAAG
CAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGCCTTTGCCCGATCCTGGTCGGCCTTTCAGTGTCGTCTTTGACGCATCTGACTTTGCCATAGTCAG
TGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAGGAACTATCCAGTTCATGACAAA
GAGCTACTTGCTATGAAGTACGCTCTTGTCAAATTCAGAGTACATCTGTTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTG
CGACACCGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTCTCATTCTTTGCCGAATATAACTTCGAGGTGAAGTATAAGCCAGGAGAGCAAAATGC
TTTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAG
GATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGAT
ATTCTATCGATAATGTCCTGTTGTGCTATCGCATAGATATTGAGAATAACCCTCGTATCGATGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTA
TGAGGCACATGATACCGCTTCTAGTAGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAACCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTT
AGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGG
AGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGCCAACACTGGCATTGTGGTCTTTGTTGACTGATTGAGCAAGATGGCTCACCT
AGAGGCTGTGCCGGACTCTATTGATGCCGAAGGCACAGAGAAGCTGTTTATCGACCGTGTATTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGAT
AGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTTGGCACCCGTATGGACATGTCCACAGCGGATCATCGGCAGACCAATGGTC
AAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGTGCAGTGTTTGCGCTGACACACCTATGCGTTGGAGCTCCATGCTCCCTGATGTTGAATTTGC
GTTGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCA
GGGCTTGGTGAGGGAGAGGTTGCCGATCAGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTTTCGCAAACGCGATTAAATGTC
TTAAGACATGTGCGTGACGCAATTGCTGAAAGCCAAGATCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAG
ACCAAGTATTACTCAATACTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAAACAAAGTTGCGTCCGTGCTTCATTGGAACATTCACGGTCAC
TGCCAAGAAGGGAGTTGCGTATACGCTCAACCTTCCACGCAAATTGTGCACACATCCGGTGTTTTACTTGGGCTTGCTTAAGCCGTA