Description :
From Genome Similarity Track
Location :
Scaffold_6:2216410- 2220095
Transcript NameFunction/comments
Phyin_T30-4PITG_04698Arginine biosynthesis bifunctional protein ArgJ%2C mitochondrialGlutamate N-acetyltransferaseAmino-acid acetyltransferaseArginine biosynthesis bifunctional protein ArgJ alpha chainArginine biosynthesis bifunctional protein ArgJ beta chain
Phyin_T30-4PITG_04699Putative uncharacterized protein

Sequence
3685 bases(100 bases per row)
TCGAGTCGAGTTTATGACGAAAATGTGACGCTCAATCTACGAGCGGTAGTCAGCATTAATGGCCACGTACTCGTGCGTCAGGTCGATGCCCAGCACCTGC
GTCTCCTTGGAGCCAACACCCAGGTCGATCTCAATCTGCAATAATAAATCAAACAACCTGTTAGCACCTCACGCAATAAACATCGTTACGTCAACGCTTA
CCTCGACAAACTTCCCGTGCGGCGGGTAGTTGTGCGAGCTGGCGTCCAGTCCACCACGCGTGGGTTCAATCAGCATTGCGTCGCGCATGTGGGCCACCAG
CTTGGCCTCAATGTCGTCGTTGAGCACCATCTCGCCGTTCTCGAAGATGACAACGCCGCCCATCCGGATCTTCATGCGACGCTGAATGTTCACGTCCTTG
TGGTACGTTCCCATGTACTTGCCCACAGCCATGACGAGGCGGCCCACATTGGGGTCGTTGCCAGCCACCGCACACTTGAGCAGAGGCGAGTTGACCACCG
ACTTGCCGACACCCTTCGCCATCTCGTTGGACAGCGCGCCGCTCACACGCACACGCATCACGTGGTGCGCACCTTCACCGTTGCGTACAATGTCCTCGCT
CAGCCCCAGACACACCTCGTGCAGCGCCGTCTTGAACTCGTCCAGCTGCTTCATGTCGAACGGGATCTGGTCCGACGAAACGAGCGTCACCGTGTCGGAC
GTGCTCTGGTCCGTGTCCACACTCAGTGAGTTGTACGTGTCTCCAACCACCTCCGTCAGTAGTTGACGCAAGACGTCACGCGGGATCGACAGATCTGCAG
CAATAATTGTGAGTCTACTGTGAGAACTGATATCAATTCACGTTGCCAGCACGCACCGGTGAGGATGTAGGACAGCATCGTCGCCATGTTGGGTTCAATC
ATACCGGCACCCTTGGCAATGCCGACGATGCGACCGCCACACACGTCCATGGAGCGGATCTTCGGGTATAAATCTAAGGTAGAACATGGGTTTTATAAGC
TCTTAACTGTAAGAAATTATACACATTAGTTGCAGCCCTACCAGTGGTCATAATCCCCTCGGCAGCAGGTAGAACGGACTCGGACTGCAGGTTGGTGACG
AGCTTGGGGAGGTTCTCGACCATAGAGTCTACCGGGATGCGCCATCCGATGACGCCCGTGGAGCAGGGCAACACCTGAGAGCCTCCCTCCAGTCTAAGGT
GCTTGGCTAGATTCTCGCAGACTTCTTCGGCATCAGCCACGCCACCACCACTGGCGCAGACGTTGGAAATTTTGCTGTTGACGAGGATGGCGCCGAGTTT
TGGCTCGTTCAAGCGCTTGCGACCCACAAGGACAGGGGCACCGGGGAAGGCATTCTGTGTGAACACAGCAGCGAAGAGAGACGTGGGTTTGACGGGTTTA
ATGAGTGTCATGGTCATCTTGGCTGGCAGGTGGGGCGCCTCTTGTGGCACGAAATCGAACTTGGTGGTGGCCACGGAGAAACCCCAGGGCAGGCGGCTCT
GGTGCGCCTCGAGGTAGTCCATATACTCATGGCGCGAATCGAACACGAACGGATGACCGTGAGTAGACAGACACCGTGTCTGCAGCAGCGACCGCGAGCG
GGAGAGCGACGACAAGCGCAGGAACGACATGACTTCAATTCAATTGTGGGCCAGTCGGGAAAGTTAAACCGTTTTCGGATTTTTCGTATGGACATGTAGA
TCGGCCCAACGACCAATCACAAAACTTCAAATCTTTTGTCTAATTACCGGTAAGCTAAAATTTGCCAAATTCTGTCACAAAAAAGTATGCACAATTTTTG
GTGTGTGTTGCTTTAGTCCTCCCCGCCAGTTTGCTCTATTAATACCGGTATTCTAGTTCAAAGAGCAATAAGGAAATTATGGCCGAGTCGCCGCTGCCGC
CGCCTCCTCCGCCACCTCCTCCACCGCAAGACGACCTCAAGAGAAAGAAGCCGACGCTTAACAATCCCAACCAGCCGAAGCCCAGGAAGAGAAAGGACTT
CCGCGCGATCATGGCGCTGTTCCACGACGAAGGAAAGGACATGGCCAAAGTTAAACGCGAGTGGGCCGCGTTATGGCAGACAACGCTGACTGAGAGTCAG
GAGGACCACAAGCGACGGCGGCAGCAGGAACAGCACGGCATAAAGCGCAAAAAGAACGAGCACGATCATGGCCTCATGTCGGCTCGAGGTGGGCTGGGAT
CGCGTCTCGGCAGCATGAATCAGGACCACCTCAAACGGGCACGACAGGTGCGGCCGTCTTTGCGTGTGTTTTTGTGTTCCCGCTCGTTTTTCTGACGGTG
TTTTGTGTGTTTTAGGGCTCTACGGCAAGTACAGACTCGTCAGAGTCGAGTAAGGGCAGTCGACTAGGAGGACGTTTCCCCAAGAACATCCCAAAGGGGT
CCAAGCTCATGCAAAAGTTTGGTGGTCGTACTTAATATCAAGCGTGCGTAATGTGAAGAGATTGAAGACTTTTAGTCGTTTCCTTGACGCCTTATCGTTG
ATGAGGATACATGTACCGGTACTCTGAAATCTGGAACTTTATGGCAGTGGCGCGGAATCATTGTATTTAATGTGGATGGATTTAGTGCCGAGTAAACGGC
TTTCGGCTACATACAACGACAAGTAACATTAAGCTATACATTGGACTTGGGTAATGACAGCACTTGAACTATAAGAACGATAAGGTGTCCACGTCGGTAT
TAACGTCATTGATATCTCCGAGCAGAGCGTCGATCTCGCAGTTAAAGAGCACTTGGTCGGTCTCAATGTCACCAAGAATGGCAGACACATCGAACTCGGT
CAGCATGCTGGTCGATACCGTGCTGTCAAGCTCGAAGCAGCAGTCCAAGACGTCATCGACATTGATGCAGCTGCTGCCGTTGCCAATGTTGCTGATGCAA
GCCAGCTCGTCGACTAACGAGACAAAGCCACCATCCCAGTCCAGAGTCTCCAGATCAACAGAATCAAGTACGTTAAGCAGCAGAAGGCCGTCATTGAAGC
CGAAGGTGGCGTCCTCCATTAACCACAGCGGATCCACGAATGACGCGGAGCATACGTCCGACAGCTCGTCGATGGCGCACACGTCGCGCGGTGACATCTT
GTGCTTCTTGGCTGAAGTGGTGAGCTCGGTGGTGAACTCCAGAAGATTCCGAGGTCGCTTCATCGACGTCGTTGGCTTCACCGGAGCCGATGTCATCACA
GCCCCAGCCTTCGCTTTGAGCTTCATCTGGCCCACCATGCCGGCGAGCTGGGACGTGTGACACCGCACGAGCACCTCGTGACTGAAGGTAGCGACACTAG
CGCGCGTCTTGGTCCACTTGTGGAACCCGAAGTTGTTGAGCTGGCGTTGGAAGCTGGAGAACTTGCCGTGCTTGAAATACTTGCGCAGCACCTCGGTCTC
CAGTCTCGGCACGTCGTAGACCTGGAAGTGAGATCCGTCGGCCGACCAGGATAGAATGCGCTGGTCTTCGTTCTGGAGCATGTCGTAGACGGTACGCACG
AAGCGAGGCACGGTGGCGAAGGTCACGTCGTTGGTATTGTTACTGTCTATATTCATGTTTAGGCTGCTTTGGTTGCTTGTCGTAGTGGTTGGTTGTGAGG
TTGACCCGACTGTTGTTAGAGTGGTCTGGGCAAATGGAACCCAATTGAGTAGTGACGGATCTTCCTTCTCGAGGTTCCATTCGCG