Description :
From Genome Similarity Track
Location :
Scaffold_27:221546- 235145
Transcript NameFunction/comments
Physo_133645predicted protein
Physo_133646putative phosphoglycolate phosphatase precursor
Physo_133647hypothetical protein
Physo_133648actin related protein 2/3 complex, subunit 1
Physo_133649hypothetical protein
Physo_133650hypothetical protein
Physo_156790hypothetical protein

Sequence
13599 bases(100 bases per row)
GATGGTCAAGACGGTGGGCGGCGGCCAGCTCGTAGCGGCCTTCGGCGTGGGCGTGGCGGCTGCCATCGCAGCTCAGTACGTGTACCAGGTCGCTCTCAAG
CGTCAAGCAGCCAACGCGCGCGTGTCAAAATCCACTGTGGCGGCCCCCCGCGGCACTGCCGCCGCCGCGCAGGAGCTCCTGGAGGAGCAGCTGTCCCGCA
TCGCCGCCTTCTTCGGACCCGAGGGCTTCGCCAAGGTCAAGGACGCGTTCGTGGTGGTCGTGGGGCTGGGCGGTGTGGGCTCCCACGCTGCGCACATGCT
GGCGCGCTCGGGCGTGGGCAAGCTGCGGCTCGTGGACTTCGACAACGTGACGCTGTCGTCGCTGAACCGCCACGCGGTGGCCACGCGCGCCGACGTGGGT
CTGTCCAAGGTGGCGGCCATGAAGCGCCACCTGCACGAGATCGTGCCGGACTGCGAGATCGAGGACATGGCCGTCATGTTCGAGGCGGGCAGCGCCGACG
AGCTGCTGGAAGGTGAACTAGCGACCTTTACACAAAGGTGGAGAGGTTGAAACATCGACTGACGCAGTGGTGGTGGAACAGGCAACCCGACGTACGTGCT
GGACTGCATCGATGACGTCAAGACCAAGTGCGCGCTGCTGGAGAGCGTGACGCGCAAGAACCTCAAGGTCATCACGGCCACGGGGGCGGGCGCCAAGGCC
GACCCGACGCGTCTGCAGATCGGGTCGCTCAAGGATGCTGTCCGTACGTGATGTAGAGCAGTTCTTCGTAGTTAAAAAGATGCTGACGATGTTGTTGTTG
CCGTTGTGAAGGTGACCCGCTGGCGACCAAGATCCGGTACTTCTTGAAGAAGAAGGGCATCTCGTCGTCGGAGATCACGACCATCTTCTCGAGCGAGAAA
AGCGTATGCAAGCTGCTGCCTTTGGGTGCCGAGCAGGCGCAGAACCCCGAGGAGTTCGGCAACGTGGAGAACTTCCGCATCCGCGTGATCCCCGTGCTGG
GCACGATGCCTGCGCTCTTCGGCCAGTCGATGGCGGCGTACGTGCTGTGCGACCTGGCTGGCAAGAAGATTAACCCGGAAGCGGTGGCGCGGCTGTCGCG
TGACCAGCGCAACAAGCTGTACCAGAAGCTGCAGCAGCGCGAGCACGTGCTGTTCCACGAAGGCCACAAGATTGAGCTGGAGAAGGACGAGATCGAGTTC
GTCTACCAGGAAATCTGGCGGGGTCGCAGCTCCGTGAGTGGAGCAAGAAACGGCGGCCACGACCGCCTCTACCTGGCGCGCTGGCGGACGGACCGACCGC
TGCACCCGGACAACGTGGTGTACCTTACGACCAAGGAGCTGGCCAAGCTGGACAAGGACGGCGTCGAGGGCTTCGACCCGGAAGTGGTTGCCCGCATCGA
CGCTCGTCTGGGCCAGTTTGGCAGCTGGGCGGTGCCTCAGTAGAGACAAAAGTACACAACTACAACTTAGAAAGGGCTCGGCCATTTTGTAGGCGATGCT
AGAGTGCCACAGGTCGAGCTTGCGTGTATCGCCGCAATAGGTGAATAGACTTGGTCTAAAATGGAGACGGCACGGTAGTACCATTCTGCGACATGAACCG
AGTACGTCATTGGTTTGGTTTATCTTGCTTTTTGTATGACTTCAGCCGTCGGGTACCATGCCTGTCCATGCCGCCAAGGGCTCACTTAGCATTCCCCAGG
AGCTGCGCACGACGACCACCATCCCCCCTCCTCCTTTAGCTATGGCGACCTCGAAGAAGATCACGCAGAGACTGACCCGCGAGAGCTTCAAGCAGTGGCT
CCAGGGCCTCGACGCCTTCCTCTTCGACTGCGATGGAGGTGCGCTGCTTGTGTGAGCTCAACTGGCGCAAATGGAGACTTGGACTAACGGTGCTGATTTA
TGCAGTGCTGTGGCGTGGAGCCGCCCCGATCGAGGGCGCTGCCAACATGATCAGCCTCCTGCGCTCGCTCAACAAGCGCGTGGTGTTTGTGGTGAGCTGG
AGCTGTTGAGCCTATGGATCATGTGGGGAAGGAGACTGATGATACTCTGCGTGTAGACCAACAACGCCACCAACAGCCGTGCCACCTACGTCAAGAAGCT
TGGTACGTTGCTGCCGTTTCTACCTTGACTCAGGTCGCAGTGGCTTATTTAGAGTGTTGTTTGGTGTGCTCTAGCTTCGCAGGGCATCACCGCTGTTGAG
GCCGACATCGTCACGTACGTTGTGTGCACTGAGTTCATACAAGGTTTTGGATAGCAATCAGCTGATGGTATGTTTGTTTACCGTGTTGCTTTGCAGCTCG
GCGTGGGCGACCGTGCAGTACATGAAGCAACACAAGATCGAGGGCAAGGTCTACATGGTGGGCGAGGCCGGTCTCCAGACGGAGCTGGAGCTGGAGGGCT
ACCAGGTCAGCGGCATGGAGCACAGCGACATCAAGGGCCTGCCGCACGTGCCGGAAATCGACATGGAGACCAATGCGGTTGTCTGCGGCCTGGACCGGTA
TGGTAGCAGGAGTAGGCAATGCTTTCTCTAGTGCGTTTGCGCTCATTGCCTTATTCTTTTCTGCAGGTACTTCTCGTACTACAAGATGGCCTACGCCACG
GCCTGCGTCCGTCAGATCCCGGGCTGCCACTTCATTGGCACCAACCCGTGAGTGACTCCCTTTGGTTGAAGCGCTATTCTCCGTGGATTTCTCATTTCTA
ACTTGCTGATGTATGCTCGGTATCCTCCAGTGACCAGACGTTCCCGACGGACGGTGCTATCATCCCTGGTGGTGGCTCCCTTGTGCACATGCTGGAGTGC
GCCATCGGCCAGTACGTGTCAATCTCTCTGTTTCGTGTGAAGTGATGCCTATTGAAGCGCTCGTGCTAATTTCTGTACCATTCTTTGTTGCCTGTAGCCC
CCCTGAGGCCGTGTGTGGCAAGCCTTCGCAGGACCTGCTGCAGACTATTCTTGCCACGTACAACCTGGACCCCTCACGCACGTGCATGGTACGAACGAAC
TCGACAACTAAACAAGTTGTAGAAAACTTCGACTGACTGGAATTTGTTGGTACTGTACTCAGGTTGGTGACCGCCTCTCCACGGACATCGAGTTCGGCAA
CGCCGGTGGCCTGAACACGTTGCTGGTGCTGACTGGAGTCACGCACGGGTCGGAGCTGGGCAGCATCGAAAACGTTCACCACGTGCCTGACCACTACATT
GACTCGGTTGATGTTATCAACCAGCTCCACGCCGAGACGCTCGAGAACTAAAGTGGCCGCTCACGTGATGTGATGAGCTCGCGCGATCAGTTCGATTAGC
GTAGGATAGGAGTTTGATCATTGTTTTACCGTCTTCGAATGGGCACCTCACTCCAATGTAATAGACGCAATCAGATCACTGTGAATGTTCGGACTGCAAT
TCTGAGGTTCATTGACCGGCAACATCGCGCCACGGTTAGTATCTTACACTATGAACACCTACAGCAAGCTACACTGACGGCGAAACATCTCCCCGAGTCT
TTGTTTTCAGCCGAGGAATTGCGCTACTATTGCCACTGTTCACGAAGGCGTCGAACATGGAAAACCCTCCACCACTTGCACCTGTGCCAGCACCACCTGC
AGGAAGGCCGAACCGATTCGCGTTGGTAGTTTTCTTCGGACGAACTGGGGCTGAGTTCATTCGACGTGCTGAGTAATCTTTCGCGGCTGTGCTGCGAGCA
CTTGCGGCACGGGGGGCAGGCGATGCAGCTCTTGGCTTTACCAGAGCCGAGCCTACCACAGGGAACATGAGAGGTGTCGGGGTTCGCAGAAACCGTGGCA
TCGGTGATTTCGCAAGTCGCTTCGTGATCTCAAAGAACTGCAGCTTCTTCGTTGGTGTCACATCTTCATCAGCCGCTCCTCGCGGCCGCTTTCGGGACGG
AGCACGTAGATTTTCAGGTGAGTCATTGTCGCTAATCAGGCCACTGCTGTTTAAACTGATGTTCAGGTCTCTCTCCTCGACGACCTGCTCACGTTGAGGA
GGTACCTCAACGTCTGCGGTATCACTTTGTAGCACCTTCCGGAAATCCGCCCGCTTCGCCGCTAACGTTTTCGCTGCACCCTTGTTCTGCGTTTTCTTCG
TTTTCTTGCCTAACATTTTCGGTGTGCTGATATCTTGCATCTTGTTCATCCGCGCGAGCAACTCTGCATTTGCTAGACGCTGCTTGATCGACATGGTTTC
GGCTTTACCACCAACTTTCTTCTTTGGCGCCGGTGCTGAAGTGATTTCCTCTTCCTGGTTCGATACAGCTTCAGATACCTGGAGTTTCGCCTTGAACTGC
GCACCCTTGGTAGCGTTTGTACTGCTGGCCCCCGTGGCATTTTTCCGGGCACCGTTACTCGCTGTCGTTGCTGGTTTGGCTCTGTTAGCTACAGCGTTCT
TCTTAGGTTTGACTGCAACAGCAGTGTTCGCCATAGCCGCCATCAAGTTTATCCCTCCAGTCGATGTGGCAGCGCCAGTTGCGTTTTGTCCCTTCGACAA
ATCCTTCCGGCGCTTTAAGCGCTTCTTTGGAGTTGGTGTTAATGGTACAGGCATCGGTTCAGGTTCCGAGTCTGCTTGATCACTTTCACCCTCTTCAGCG
CCGGCAGCGACCTCCGCAACCTTTGCCTGCCTCTTCGCTTCCGCGTTGGAGAAGTTGAAATCCAGTGGTAGGGCTCCTTTCTTCTTCGCGAACCGCTTCT
GAGGAGTCAGCGTCTTCTTCTTGATAGGCGATGGATGCGCCTTCGTCGCGCTCGGAGTTGCAGTCAAAATCAAGCTCGCCACTGACGGTTCATCGTCATT
ATCAGAGTCACTGCTCTTATCAAGGATATTGAGCAGCCCATCATCCGGCAACTCCGGTGGCGGGCTGTCATATCCACCCACCTCAACCTGGTTCTCCTCT
GACTTCGACGCTGCATCATCTTTCGGCTGCGCTGGCGGCAAGACAGTAGGAGTGATTCTCTTTGGAACTGCTGTTTTTGTCTTCTTCGCCTGCTTAGACT
CCGACTTGGCCTTCTGCACCTGTGGCTTTGCCTTCCCCTTCACGGCCTTGACGGGCATCTTGGGCTGCTGTGGCTCCTCCTCATCCGTCTGCATGTCGCT
CTCTTGCACCTGCTTGGCCTTCTTCTTCGCCTTCTTCTTTTCCTTCTGCTTCTCCAATTCCATCCTCTCCTTCTCTTTCTTTTGCTCCTCAATCTCCAAC
CTCTCCTTCTCCTTCTTTTGCTTCTCCAACTCGAGCTTTTCCCTCTGACAAGCTGCTTCCTTCTCCCGTTGGCGACGCAGAGACACTTCCTCTGCCTTTG
CTTCTGCCTCCTCACGTTCCCGTTCCCGCTGCCGCTGTCGCTCCGCTTGCTCTCGCTCCAGTTTCTCCTTCTCCTGCTTCTCCTGCTCCTGGCGCTTTAG
CCGGCGCACCTGGCGCTGGTATCGGCGCTCCTCCAGCTCCATCTCCTCCATCAGCAGGAACTGCTGCCATGTCTTCTGCAGTCGCTGGCGGCGCAGCTCG
ATGGACTCCCACTATATGTACACAGCACGAGAAGCGATGTGTCAGCTTTGAATCGGGATATCTCACGTTCTAGATGCCAGAGAAACGTACTTCCAAGTTG
TACGCCTCCAGAAGGATCTCCTCCGGGTACGGCCCGCCGACGCGGTCCGTTGCGCGCTCTGGAGACTGCATGCGCCCGCGCGTCGCCAGGCCACTCCAAG
AGCGCAAGTGTAATCTATCGCTCCCCGCGCTTTTGAAGCGATTCAAAAAAATGTTATTTGCGGCACATTACACACACTCTTAATTCCATGTGGTCCACGC
GTAGTTGAAGCTGTGCTTGCAGAGGGAGATCGGAGACACTTCTCCCTCTACAAGTCCATAATCCCTCTTTTTGCCTTCCTCCTCGAAGCAGATCAATCCG
CAAAGGGAGTCAGTCGATACAAAGCGCAAGACACACACTAGCATCATGGTAGCGGGGGGCGACGCGAATCTGTTCCAGCTGGCGGACGGCATCTCGTGCC
ACGCGTGGAACAAGGACCGCTCCAAGCTGGCCATCTGCCCCAACAGCAACGAGATCTGGATCTACTCGGGCTGCCACGCGCCGGACCCGACGCAGTGGCG
TCGCGAGGCCGTGCTCTCGGAGCACGACATGCTCGTGAGCGGGCTGGACTGGTCGCCCGTGCACGACCAGCTCGTGTCCTGCTCGCACGACCGCAGCGCC
TTCGTGTGGAAGTACGAGGCCGCCTACCGCCAGTGGAAGCCGCTGCTCGTGGTGCTGCGCATCTCGCGCGCCGCGACCAACGTCAAGTGGAGCCCCGACG
GTGCGTAGCTAGCGGAGAGAGGGGACTCGCATTGCAATAATTTATTAATTTGTTTTGTATTGGACGCAGGCAACAAGTTCGCGGTGAGCAGCGGCGCCAA
GTGCGTGTCCGTGTGCTACTACCAGGCGGCGGAGAACTGGTGGCTCAGTAAGATCATCAAGAAGCACAAGTCCACGTACGTTCATTCGTGCAGCTTCAAC
TTGGTTGGATCTTTTAAGAGGGAGTGAAGAAGCTGATGGAATTTTATTGTTTTGAATGCAGGGTGACGGACTTGGACTGGCACCCGAACAGCCAGCTCCT
CGTGACGGGCAGCACGGATCTCAAGTGCCGCGTGCTCTCAGCGCACATCAGCGGCGTCGATGGGCCGCCCGATGCCGGTCCGTTCGAGGCCATGCCACCT
TTCGGTGAGCCGCTGGCTGAGTTCGACAATGCCAGCGCCTGGGTGAACGCTGTCGCGTGGTCCCCCAAGGGCGACCGCCTGGCGTTCGCCGGCCAGGGTT
CGTCCATTCACATCGTTCACTTCGGTGCTCCGGGCGAGTACCCGACGATCCAGGTAAGTACTGCTGTTTGGACTAGAATGCGCGATTGGGGCGTGGTTTT
TGTATGCTGATGATAATGGGTTGTTTTGCACGTGCATACATGGCATGCATTGATACAGTCTATCCGGTTCTCGCACCTGCCGCTGATGCGCATCATGTTC
CTATCGAACTCGGTGATTGTTGGCGTCGGCTACGACTTCAACCCTCTTCTGTTCTCCCAGGACGCCAACAACTTCTGGTAAGGATCTCAATGAATAATTT
CATTCTAAAAAAGGTGCTGCGGCTAACGTGAGCGACTCAATCTAGGTCGTTCTCCGAATTTGTGGACAAGAAGCCATCCGAGAGCGCTGTGAAGAGAAAC
TCGGGCGGCTTCAGCGCTGGTAAGAAAAATGTCACTTTGTGCTGCTGGAGTTGGATTCGTTGCTAAACGATCTTTATGCGCTGTATTTTCTCTACCTCCT
AGCCCGAAGCCTGTTCGAGAGTAAGGTGACGCGCGGCCAGTCCTCTGATGCCACTCAACATGATAAGAATATGCTGTGGATGTACGTTGCGATCCATCTA
CATGTAGATACGATGGCCGTTTTACTGATACGTGTTCTCCGTTCGATGCAGGAAACACGAGAGCAACATCACATGCATTCAACCGTACGCACGCTCCGCC
TCCGGAGGCGTCACGGAATTCTCCACTTCGGGTACGATACAATTGAAACTCGTATGGAACTTACATATCTAACATGTGCATCATGCTGCTGCGGTGGTCA
TACCTTCAGCTCTGGACGGTCGCGTTGTCCTGTGGAAGCTGGGAAGTTTGAACGTCGAAATGAGCAAGCTGCATCTGTAAAAGAAGGTTTGCCGGCACCT
CAAAGGCTCAACAACTGAACCCTAGACTCGAGAGCAGCAGTTGAAGGTGACCAATTGCGACACTGCTAAAACGAGCCGATGCTAGAAGGCACTACAAGAT
GACGAAGCCAGGCATTTCAACCTTTCTGTCGATTGCTGTGTATCCTCCTCTTACCTTCCCACTCGCTTCTTTCGTACTATAACAAGCGCAACGACACCTC
TATTCGTACATCCGCTTTAGCCGTCTATACTCTTGGCGATACTGGTTCTCCACCACCGAGGCCTGACGAAAGTCTTTCCACTCCGGAAACTCTGTGAGCA
GCACCTTCGGGTCGTACGAGAGCAGCAACTGGATGCCCTGGCTCACGTCATTCAGCGTTCGCGCCAGGTCAATGTGGTCTGCGTTGAGGTACGTTCGCTG
CAGCTCGAGCAGCTCATAGCTGCTACGCAGGAACAGGATCGAGTACTCACACACCCGCTCGGTTTTCGCTCGCAGCAACAGGTCGCACGAGTCCGCTACC
AGCTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATTTCGAGTGCGTCCGACAGAGTCTCAAGCGCTACCGACAGAGCCGCAGCAGCGCTCT
CGGGGTTGGTCTTGATAATCTCCTCAGCACCGACCAGCACCTTTTCCAGGTCTTGCATCCCAAGCTTGGAGCCGTCATTATCATCCGCCGCAGACGCCGG
CGGCGGCAGCACGCTGTCACCTCGCTTGCAGAGCTCGCAGCTGCACTCGAAGCCGAACTGCTCCCACAGATTCTTCTGGCGGTTCTCACGACTCTGCTCG
CGCGGGTACAAGTACGATATCGTGAGCTGTTCGCCCTTGGCGATGGGTCTGGCTACGCGCACCTCCGACACTCCTCCTTCCGCTCCAGCGTCCTCGGGCG
TGAACTTGACACAGTTCGGGTTGCAGTCGTGGTTGAACATGGCGTTGTACAGGAAAACTCCGCTGTCGAAGGCGTTGCACTGCATAGCGAACACGTTCTG
CAGCACCTGGTCGTGCACCAGCGCCAGCTCGCTGAAGTTCCTGCAGAGCTCGTCCACCTGCGGGCCGTACTTCTCCCTGCCCGCCGCCAACAGCTCCTCG
GGCAGTTCGCTCAGCTTCTCCGGGTACAGGTGGCTCATGTGGCCCATGATGTCCGCGTAGTCGGGTCTGGACAGCACCGACTCCATCGTGGCCAGGAAGA
ACTCCGGGTCCGAAGTGTCCACATCGCTGGGCCAGGGCACATACACCTGCTCCACCAGCACCTGCGTGCCCGGCTGCAGGTCGCGCGTGGCCACGTAGCC
TCGCGATCCTCCGACGCCATTGAAGCTGGTGGCCAGGTCGATGGGCCCCACCGCCAGGGGCTTGACGTCGTCCCAAGGCGCGTACAGACTGCGCGAGACT
TGCGTCTTCTCGTCCTCCGCCTCCTTCGCGCTGGAAGAAGCCGCAGCGGATGCGGACACGATGTGCACGACCTCGTGCGGCTGCACGACGGGCGCAGCCA
CCTCCTCGTCGCTGCTGTCGTCGTCGAAGAGCCCGAAGGCCGCCTGCACGGTCGCACTCGGCTTGCCACTCATGAGCGCTGGTGGTTCACTGACGTCGAG
GTATCAGCGACACAAGGCGCACACAAATTGTACGCAAAAGACCGCAGCATTTATGCTTGTACTTGATTTTCGTATCCTGAATACAAACGTCAAGTACATA
TAGCGAGGGAGCCACCACTGGCTTTTGTGGTTCTCAGTCAATCGCAAGTACGCTACTGTAACATGGCCGAGGACTTGAGCGGCATGGCGGACGGCAGCGT
CGCCGGCCGCACGCACCCGCGCGCGGCTGCACCGCAGCAGCAGTTCATGGAGGCCTCAGGCCTGCCGCCCTTCTCCTCCTCCTCCTCCTCCGACCAGCAG
CAGACGCCCGCCGCCACGCCGTCGGGGCTGCCGGCGGGCCGCCGCATGCGCCTGACGCTCGGCCAGAAGCGCGAGGTGGTGGACCTGGCCGCCAGCAAGA
AGTTCACGCACCGCGAGCTGGCCGAGAAGTTCCGCGTGGGGCGCACCACCATCACCAACATCTGCCGGCAGGAGGACCTCATCCGCACGGAGACGGACTC
GGCCGACGCCACCAAGAAGAAGCGCAAGACCACCAAGTGCACGTACGACCTGCGCGTGCTGGACGAGTGTCTGCACAAGTGGCGCATGGAGATCAAGGTC
TCGAGTCCGGACACCAAGCTCACGGGCACGGTGCTGCAGCACAAGGCCATGGAGCTGGCCTGCAAGATCGTGCAGGAGCCCTACGCGGCGCTGCCCGACA
AGGTCAAGCAGGCGCTGCAGAAGTTCACGGGCTCCAACGGCTGGCTGGACGGCTACAGGACGAGGTTTGGCTCCTTCAGCAGCAAGCAGCTGCCGGGCGG
AGCTGACCAGAACGTTATCAAGAGCGTGGACGTCCAGACGCGGCTGAGGGAGCTGCACCACAGCTTGAGAGGCGTGGATCTGGAGGACATTTGGACGGGC
GGGGAGTTTGCATTGATGTACAAGGCACCGGTACCCGAACCGGTGGGGGCGAATGGTAGTGGAGCTGCAGGCAATGGCAGATACACGGTGTCGCTGTTCG
TGAGCGCAGCGGGGGAGAAGTTTGATATGCAAGTGATTGGCACGGATCGCAACCCGCTGCTGCTGGAAGGGGTGGACACCAGGGAGACGTACAACATTCA
GTACGGCTACTCGAAGACGGGCTGGCAAGTGGCGCAGACGACTGTGAGCATGCTCAAGTCGCTGAACGCACGCGCTCGAGGGCGCAAACGCACGTTTCGC
GTGATTTTGGACTCGGCTGTACCGCACGTCAAGGCTGCCATGATCTTGGACTCGCAGGGAGACCAGCGCACGTTCTTCGTGTACGACCATCTTCAGATCT
ACTTCCTGCCGCCCAACTTCAAGGCTTCCCGCTTCCACCCGTGTCACCTTGGAGTGATTCAAGCTTTCAAGGCCCGTTATCGCTGCGAGATGCTGGAGAC
GTTGTTCAGCAATTACCGACAAAGCGTGATAAGCCAGGACCCGCGCGGATTCCACCCACAGCGCCACTTGCACACTCGCAACGTCTTCCATTGGCTATAC
GTTGCTCTCCACAGTCTCGACAAACATCTCATTCAGACGTGCTGGGTACATAGTGGTCTGTTGCCCACCCAGGCCATCGCCTCGCTCAGTTTACGTGCCA
TTCTGAGCACCCCCGCTAACCCGTCTCCGAACAATTCCCATGGTAGCGGCAGCGAAAGTGGCACTGGCAATGCGAATGGCAGTGACGTCAACGGAGTAGC
ATCTCACGAAACGGTAACTGGTGCTGGTCCGGCCGGGCTGACTGGCTTACAAGGCGGTTTGCCGACCGCAGCGCTGTTATACCGAGACTTACAACGGCAG
CTGACGAAAATCGCCCAGCACGCCCCCGACTTTCTGCGCTGGATTGGTGTGAGTGACCCGACCAATGCGCAGTCATTTGTGGAGATGGAAGGCAACGCCT
CTGTGACCGACCCAGGGATCGATGAGGTGCAGATCATCCGCGGCGTGCTCCAGAAGCATGGATACTTGTCAACAAAGAAGCTCGACGATGATAGTCACGG
GGCTGGATCATACGAGACCTTCGATGATGTGGCGGAGGAAATCTGCCCACGACATGATGAGATCTTGGCGTCAGTCGATGTTCTTAAGAAGTACCTGCGT
CTATCGAGAGACGCGATACCGAGCCGTGTTGAGGCTGTAGTGCAACTGAACGAGATCAAGAAGGCTATCGATGCTGCCGACGCGTTTCGTAATGTGTGAA
TGAATGAGTGTGCGATGTCGTTGTATACTGCATGCGTTTGTCATTGTTATCTATCGTACTATGGTAGCGTTTTAGCGTTTATCGTACACGGTGGCCTAGT
ACACATTACGGATCTTATAGTTCGGAGGAATGGCCGCCATCACGCGACTGTCATCGAGTCGTCGAGTGGTCTGAGCCCTTCGCGGCGACGTCTGTGTGGG
TGAAGCTAGTTCAGGCCTCGGTTCGTCGTCCAGCGGCAGGATTCCACGTTCCGCAATGGCCTGTTGCTCAATGCGCCGTTGCCGTCGTGCGTAGGCTACG
AGAGTGCGTAAAGCACTGACAAGCCAGTCGCGGTGACTTGAGCTTTGAGTCTCGAGATCTAGCGTGCGTCCTCGAAAGACCACCGAAAACGAGCAAGCCT
CCAGAATACGGCTGGATGCATACTTGCGAAACACAGCCGTCTGTCTGCCATCCAGCACTTGCAATACCTCAGCCAAGTCGACGGCTTCACTCAATCCTCC
GCGCTTGTGCTGCCACTGCAGTGTTCCACAGCAGTTGCAGTGAAGTCTGGTGGCGTGAGCGCCACCACGTCGCCCATACTTGAGAAGAGGGAAAAACATG
TTGATAGCCTGCACCAGATACGAGCGGTGCTTGCCGCCGAATCGGAAAGCCAACTCAACGATCTTCCACCGCGCACCTTCAATGGTCTCCAGCTCTTCGT
CCGTGAACAGGTATGTCTTCCGCTTCTTCCGTAAGTGAAGTGTCTCCAGCACGCGTGGACCAAGTCTTGAGAACGCGCTCTTCTTCTGCTTCTTGCCAGG
ATGAAAGTCTTGTGGAATGAGCGCAGGTCGTACTGCTGGTGGTGTGGGCATCGGCGAGACATCTTGAGGCGGCATGAAACCCTCCAGCCCCAGGTCGTAT
GCGTTCGGGCATGACCCTGCTCTCCTCCGCGTCGGGGTCTCTCTGGACTTGGGGCGGATTCCGTAAGATTGAGCTAGCGGTTGGCGCATCTGGTCAGAGT
CATCCTTCAGCTCGATCACTAACCGCCGCACGCTTGAAGTCAGCTGGTCTTGCGCTGACTGGGCGGCTCGCTCGGCTGCACAGCTCAGAAGGCGGGTGCG
TCGTCGCTGCAGCAATCGGTGCTCCGCCGGACTTAGCTCCTGCACCAGTTGCTGCGCGACATGGGCAATCGTCTCTTCTTCCGCGGCGCTGGATCTTTCA
TCTTCGTCGTTGTTGTCCAGATGGAGCTGCTCGACGTCGTCGATCTGGTTAACATCTTCGTCCTCGTCTTCATCGTCCGAGTCGTCGCCATCTTCCTCGT
CTTGGTTCGACACGACAGCCGCCTCCGCCTCGGTCAGCAGACTCGCGCTCTCTATCCGGCTCATCAGCGTGCGCACGCTTGCGGGCATGCTCACGTGGTC
AAAGTCCAGCAATGCCTCGTCATCTCCAAACACTCCGCTTCTCCTGCCAGCCCCAACTTGTGCAACCTCCTCCTCCTCAACGTCAATAGTAGCTCGCCGT
TCCTCCTCCTCAAGGGTCTCCTGCTCGTTGTTGTCCATTTCTTCCTCCTGCGGCTCTTGGTCTCGTTCCGCCATCATCACCTCCTCCTCCTCCTCCCTCT
CCTCCACTTCCTCCTTCTCCTCCTGTTCATCCGGCAGCGGAGGTGCCGGTGCAAAGCCCGCGTGCATGGCAGCAAAGTCCCCGATCTGCGCTTCAAGTTC
TCCTCTCCTCGAGATCTCCTCCGGACTCAGAGGGCGAGCCAACGCCGCCGCCACCAGCGTCCGCGTCGGGTAGAACTGGAACCGCTGCGCGCGCACGCCG
CTCCCGCTAGCTCTCGGATCCCACATCGTCATGCCCGACTGCGTGGGCGTCCCAGCGATACTGCTGCGTCGCGCGTGGCGCGCGGCCTGCGCCGCCGCCA
TCGCGTCGTCCTCCTTGTCCTCGTAGCTGCCGCTGCTACTGCTGCTGCTGCCGCGTGCGTCCTCCGGGTTGGCCTGGAACAGGCTGCCGCGCCGCACGAT
GGCCGAAATCTTGCCGAGCAGCACCACGCTGGACGAGCGCTCGCGCTGGCGGCGGCCGCCCGCCGGAGGTGCCCACGGCTGCATCGCGTCGGCAAATGA