Description :
From Genome Similarity Track
Location :
Scaffold_120:22153- 27515
Sequence
5362 bases(100 bases per row)
ATCGATCCTTATTCCTTCTGTGCTTGAACAGGCCAGAAGATCAATCTTAACCGATACTGATTTGAGTCCTCCAAAGCTATCCACGTGTGTAGAAATTGAC
GACCAGTCTATAGCCACTCATGTCCTGCGTCACGTTGGTCGGTGGTGAACAGCTTCCAAGCGCGTTTAAATGAGGGCACCCAGTAGCTGATCTCGACTAG
CGAGATGGAATCGACGGTATTATGCATCCAGAGTCCGGGTAGTAGCAGAAACACGAGAGACGACGGTACGAGCGACGGTAACGCCTGAAGATCGGGAGGA
GTAGTGACGGTATCGTAGAATCCTAGCTGTTTCATTGGCCAAAATAAAAAGCGCTAAAACTACAGTCGTCCATTACTCCGTTCCGCGCTCTTGAGAACGA
TCATGACGTGGCACCACGTAGCAAAACCCACTTCGCCTATTGCGCACTGTTTTGCGCTGCGTCGCAGGTCTCAGTTTATTCGTCTGCTTCTTGTAACGAT
GGTAATGTGTCATAGAGATTCACCGTGAAAATTTTAGAATTAGGAGCATAAAAGAAGATCAATTTAATTTTAGAATTTAGAGAACTTCAAATCCAATAAC
TTGTTTAATGTATGGGGTGAAGGCTCATTAGCGAAAACTGAAGGCTCATTAGCGGTTCCCTGTAAAAATCGGTTTGATATTTACATTATGCAAATATCAT
GTAAAGAAAATCCCGGTGCTTTCTTAATGGCCACGACCTCACCTACCTTCGACATAAAGTCCGAGGATGCACCCAGCTTCTTGAAGGGGGTCCCACCAGA
CATTGGATTGGGCCACACCATTTCGTACAACTTCTTCAGCGGGTAAGACAGCATGTCTAGCATTGTACTGAATAATACTTTTAGCGCTCGAATGAATGGT
AGGACATCATAGAGGTGAAAGCAGAACCTACCTTCGTCCCCATCTCCGGAAGTCCCCGTTCATCAGCAGTGGCGAGTTGAGTGGCGTCTTTTCCGCGAAA
CGAATTTATTTTCGTCACGGTGTCTAGAGTGGGCTGGTCCTGGTTTGGCGTAGACATGTTATTGAGCTGTACCGCGGTGCGAGCTAGAGGAGCACCGCTG
CCAACGGACACGACGAACGTGAGGGCCAGGAGCAAAAACACGTGGGAATTGCAGCACGAAGTAGTTCCGATTATTTGCGAAGTGAACGTTTGTGATAAGC
GAGACTTTAAATATACTAACTTTTTGCCTGAATACACTAACATTTTCGGCTTTTTTTCATTGCCCATTTCAAACTGTGCCGGCTATCCGTTAGGTCTAAT
TATTGTATTGCCAACAGGGTTTAGCGACGGGCCACTTTTGCGAGCCCCGGTGATGGTGGCCTCGATTGGAATCGACATCAACACGTTCACCCCGCCATCG
TTCTTTTATCCTTCAGCGTAGTGATAGCGCTTAAGGTCGACTGAGCTCACGACCAAGGGTACGGCTTTCTAAAACATTGCTTGCTCAGCACTGTGATAAA
TACACTGGGTACCACGGCTTGCAGCACACGCAAACAGGTAAAGCCCTAAAGGAAAGTGAACAGCGTTATCCAAAAGGTTGGAAGCTAATCGCATATCCTA
GCCCTGCTCTTGGCAAGAATTCCTTCAAAAAGCAAAAGTTACCTTACTTGCTTATATATAACTCGAAAGTGTCAAGCTTGCACATTCGTGCGTCCCCGTA
AAGAAGCTTCAGTCAAACGCACCTGGAGGACCTTTGTATCGATATCGCTCTTTCCGCGTTGTGCACTGCTCCACTAGTACCGTGGTATTTTATGACATTA
GGATGGTGGCCATTACCGCCTTTGTGCAATGAAAACGTGGACTTACACTTTCGTCGGGTGAGTGCATTTCAAGCCTGACCCGGGGACCAAAGCAACCGCA
ACGTTTTTAGTAATACGGTCTTGCAAGGTCATGCATGGGCCAGTCGTGATATTGCCTGTATCTAGAAGCCCTGTATTTCTCTCGGTGCATCAGAGATAAC
GCGCATAGTCCCCACGCAGATAGCTGCGTAGGATGCGAACGGCGAAGCCTTGGTTATTGGCGTACTTCTTGGCGGTGCCAAAGGCTTCCTTCTGACTACC
GAAGGGCTGTGCTGGTAGAGCTTTATTGCAGCTCCACGGAGGAAGAGCTGGAATAGCATCATTAGCAACAGTAGAAGCTGCCATGCCAGAGGAGGAAGGT
GAAAGGGCTCAAAATCATAGTGAGAATGACGAGGGATTAATGAAGAAGTAACGGTCGAAAACCATGACCCGTCGCTTAACCCCTGTTGGCAATACAATAA
TTAGGCCTAATGGATAGCTGGCACGGTTTGGGACGGGCAAAGAAAAAAAATCCGAAAATGTTAGTGTATTCAGGCAAAAATGTTAGTGTATTTAAAGTCT
CCCTTATGATAAGACTGAGAAAGCGAAGCAAATCTCAACATGCGAAAGGAATGGGGATTACACGCTCGTGGCTAGCGATGCTTGGTAAAAAGTCCCTGTT
CATGACATTTACTTTTACCAGGGTTAAAACGTTAAAATCAGGGTCTATTAGCGCAATTTTCACACCAAATATCTATGGACAGTCTAAAACAATATTTAAG
GGACCTGATATTTCGAATGAGGCTTTACATGCTGCTAAAACAAGGGGTGTTGTTGACGCACAGAAAACGTCGAAATAATAATATCATGACGTGTAGCCTA
ACGATCTGTCCAATCAGAGGCCTCCAAAATCCAAATACTTGGATTATATCTGAGAGGTGAAGGCTTATTAGAAAAAACAGAATACTCATTATTAGGTGGG
AAAATATATAAAATGCAATTAATCACGAAAATAAAAAAATGCCCCAGATAATAAGAAAATAAAAATTGCTTCAGATAATTAAAAAATAAATACAATGCCC
CACCTCCTAGTATACTCTAGTCTACGTGCTATACATAAAAATTTACATCTTTTGATATTTCTCAATTTTCTTTGAATGGACGTGCTGAACCCCCCCCCCG
CAGGCGGAGCCGCATAGGGGGTTCTGCCGCGGGCGTGCTGCGCTCGCGGCAACCACTTGCGGGCGCAGACGGCACAAAATAGATTTGAACGCGTCTTTGT
ATCGTCGGCCGCTGTTGTAAATGCAGACAATCGGTGCTGATATTGTTGTTATTAATGGTATTGTTTTTGTCTTCGTTTTTTGTCATCGTTTTTATTTGTT
CTTATTTCATGTTAGTTATCAATGTTATTTTTATATAAGCTGCTGCTGTTTCACTGCTGGTGTCGTTGTTGCTGGTGTCGTTGTTGCTGATGTCGTTGTA
GCTGCTACCACGCTGACTGTAGCCGTTGTTAATACTGTTATATGTAATTTACGTTGTTTCTCTTGCATTGATACTGCTGCTGCTAATGTCGTTGTAATTG
CTACTGCTGTTCGTGTTCCTGGTATTACTACTTCACAGTGGTGTCGTTATTACTACGTTGCTGCAGTTGTAGATGTTTAGATGTGGTATAGGAATACGTT
TTCTGCTCGTACGCTACAGTTAATATAACTTTATTTTACGATTAAATAGACTACCATGAATCAATTCTACCTGTTTGAATCTTATTTTAGGGATTCGTTG
TTCATGCCCCCTCCTTATTGTTAGCCAGCCCCCACCCCTTCAAATTAGAGCCTCTGACTGATTAGAAGGCAAATCAAAACTTAATTATTCAACACTTTCA
GAACAACCACCTTGCACTTCCAGTTCAACCACCTTTATCTTAATTCAACCACTTGAATAAGGCCTAAGCTATTACAAAATCTTTTTTCGGCATGCACATG
TTAGCGTTGAGAGCAGGGTATTCATAAAAACTGTTTAATGACTAGCAAGTGAATCGAGACATTGATAGAAACGTATCCGGACCCACCTCAAGTCCCTGAT
TACTTGCGGCAGACGGTCGCGAGCACAACTCGGTCGAGGCAATTGTTGCCACGGTTGAGGTTTATGGTAAAATTTGGATACGATTGAATGGTCACCACGG
CTTCGCTCAATGCATCGTTGGTACTCCTGGTTTCCCGAGCTGTTTACCCTGTAGTACCTTGCCCTGCAAGCATACCTAGAGCAGTCCCGGAATTCCGACT
TGGCATCTTTTTAAGACATGGCGATTCATTTCCCGATACATAAATTGCTAAAGACCACATTTAGAACGTCTTCGACGTCGATCCAACCAAGGATACGGCC
AACGCCGTGACCGCTCAAGCGAAGATCTTCAGCGGCAATTTTACGTTGGTAAGTATCACCCAATAACCGGTCTAAAAACGCTAGACAATCCACCAGGTTC
TGCCCATGACGCTCTCGTGTGATCAGCGCACCGCCAGAAGATCTAGCTTCAGCTGAGACCTTCAGCCTGTTACCGAAGATACCAACAATCGCAAACAATC
ACAATCACAGCCTTTCTTGCAAACATCCTGATTACACTTACTTCTCCTTCACTGAGGCTGCAAGCATGTCAACAAAGATGTAGATGTTATCACCCTCTAC
ACAAGAAATGACGATAAGCTGATCGCGTGTTTCGGTGTCAAACTACTCAATACGTGTACGATTGACTTGTCGCTCACTTGTTCGCCTGATATCCGCGCCT
TCCTTCAAAAAGGACTGGTATACGCTACTCGGAGTTGGCCCGCAGGCTACACAAGACACCATGGTTAATCAATCAAACGACTGTTATTGTAACGATTTAT
CGCATACCTGCACATCCAGCACAACGACGCATATGTCAGCTTCACTGGCACACATCTGAGCCCTCAAAACGCCTTCTTTTCCGACAAGATCCTCAGTTTC
GCGCAGCCCTGCAGTGTCGCTGACAACTACGGGATACCCCACGATGTTCAGTGGCAGTTGCACCACAACCCGTGTCGTTCCAGCGTTGGATGACACGATT
ACTGCAGGTCGGCGCGTGAGCACATTCAACAAGCTACTCTTGCCCGCATTTGGTGGACCAAGGATTGCGACTTGGACTCCACTGCACAAGATATCTCCTC
TCCTGCCGTCAGCAGACGACCTCGGATTTAATACGCAAGCACACGAGCGCTGATCCGAAAATTGAATTGGAAGTGCAAGGTGGTTTTTCTGAAGGTGTTG
AATAATTAAGTTTTGATTTGCCTTCTGACCAATCAGAGGCTCTAATTCGAGGGGGTGGGGGATGGTTAACAAAAAGGTGGGGGATGAATAACGAATCCCG
TATTTTATCAATTGGGAAAGGCTTTACCAGTGCTGATGGCTACATTGAAGTGCTGTTACAGATTTTAGTCGGTGCTGTTAGGATTTCTCTCCAAGGAGAG
AAAGCCGGGATTGCATATTTTAAGAGGTAATGATAACACACACAAGACATTCGCTTTGGTCG